Incidental Mutation 'R7867:Cnn3'
ID607823
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7867 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121455055 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 204 (I204V)
Ref Sequence ENSEMBL: ENSMUSP00000029773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect probably benign
Transcript: ENSMUST00000029773
AA Change: I204V

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: I204V

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197135
AA Change: I158V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: I158V

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198393
AA Change: I107V

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931
AA Change: I107V

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198620
Predicted Effect probably benign
Transcript: ENSMUST00000199499
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Akap10 A G 11: 61,900,446 Y396H probably damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Mug1 T A 6: 121,873,634 D696E probably benign Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Prkaca A T 8: 83,995,334 T325S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Pten T C 19: 32,815,494 F238L probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Syne2 A G 12: 75,983,727 probably null Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
BB009:Cnn3 UTSW 3 121451429 missense probably benign 0.15
BB019:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R0812:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1368:Cnn3 UTSW 3 121457137 missense probably benign 0.01
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
R7196:Cnn3 UTSW 3 121454788 splice site probably null
R7851:Cnn3 UTSW 3 121457343 missense possibly damaging 0.85
R7866:Cnn3 UTSW 3 121451393 missense probably benign 0.16
R7932:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R8139:Cnn3 UTSW 3 121455069 missense probably damaging 1.00
R8320:Cnn3 UTSW 3 121449986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGAACGTAGGCTTGTG -3'
(R):5'- TTTTAGGCTGCAGAAAGGGCC -3'

Sequencing Primer
(F):5'- CAGAACGTAGGCTTGTGCGTATG -3'
(R):5'- TGCAGAAAGGGCCCTTTG -3'
Posted On2019-12-20