Incidental Mutation 'R7867:Mug1'
ID607834
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7867 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121873634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 696 (D696E)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: D696E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: D696E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Akap10 A G 11: 61,900,446 Y396H probably damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cnn3 A G 3: 121,455,055 I204V probably benign Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Prkaca A T 8: 83,995,334 T325S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Pten T C 19: 32,815,494 F238L probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Syne2 A G 12: 75,983,727 probably null Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTCTCCTCCAAAATGAGTG -3'
(R):5'- TGCTCCATGTAAGACTGCTTC -3'

Sequencing Primer
(F):5'- CTCCTCCAAAATGAGTGATTCAATGC -3'
(R):5'- ACCTACTACTCAATATGGTGATCCTG -3'
Posted On2019-12-20