Incidental Mutation 'R7867:Abca13'
ID 607854
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A member 13
Synonyms A930002G16Rik
MMRRC Submission 045919-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7867 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 9141942-9634259 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 9212139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042740
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C A 17: 36,272,890 (GRCm39) K252N probably damaging Het
Abi3 C T 11: 95,724,851 (GRCm39) A211T possibly damaging Het
Acaca A T 11: 84,140,350 (GRCm39) D608V possibly damaging Het
Akap10 A G 11: 61,791,272 (GRCm39) Y396H probably damaging Het
Ap3b1 C G 13: 94,619,771 (GRCm39) S778W unknown Het
Arb2a T C 13: 78,050,837 (GRCm39) M165T probably benign Het
Baat G A 4: 49,502,925 (GRCm39) L66F probably benign Het
Cachd1 A G 4: 100,845,759 (GRCm39) N981S probably damaging Het
Cacna1c C T 6: 118,753,407 (GRCm39) R243H Het
Cdh23 T A 10: 60,150,390 (GRCm39) I2527F probably damaging Het
Cinp A G 12: 110,840,557 (GRCm39) V198A probably benign Het
Clec4d T C 6: 123,244,123 (GRCm39) probably null Het
Cnn3 A G 3: 121,248,704 (GRCm39) I204V probably benign Het
Cpxm2 C A 7: 131,650,800 (GRCm39) G620V probably damaging Het
Ctrl A C 8: 106,659,497 (GRCm39) S93A probably benign Het
Cyp2d34 A G 15: 82,501,425 (GRCm39) V301A possibly damaging Het
Dnaaf5 G T 5: 139,147,565 (GRCm39) K376N probably damaging Het
Eno2 C T 6: 124,740,137 (GRCm39) D300N probably damaging Het
Entrep3 T A 3: 89,093,083 (GRCm39) Y280* probably null Het
Fam117b T A 1: 60,014,046 (GRCm39) N440K probably damaging Het
Fam131a A G 16: 20,514,584 (GRCm39) S62G probably benign Het
Fancm T A 12: 65,163,240 (GRCm39) probably null Het
Fancm A G 12: 65,165,173 (GRCm39) D1506G probably benign Het
Fhad1 C A 4: 141,632,902 (GRCm39) V1201L probably benign Het
Gdpd4 T A 7: 97,623,185 (GRCm39) C265* probably null Het
Gm3127 A T 14: 15,425,888 (GRCm39) T98S probably null Het
Gpsm1 A T 2: 26,230,448 (GRCm39) D466V probably benign Het
Gramd1a T G 7: 30,842,992 (GRCm39) K76Q probably damaging Het
Gstp3 T C 19: 4,108,808 (GRCm39) D24G probably damaging Het
Kalrn G A 16: 33,810,161 (GRCm39) T2531I possibly damaging Het
Klk7 C A 7: 43,462,333 (GRCm39) D108E probably damaging Het
Klkb1 A G 8: 45,740,002 (GRCm39) S97P probably damaging Het
Krt13 T C 11: 100,012,008 (GRCm39) D105G probably damaging Het
Lingo2 T A 4: 35,709,302 (GRCm39) H226L probably benign Het
Lrba T C 3: 86,275,896 (GRCm39) S1755P probably damaging Het
Marf1 A G 16: 13,946,470 (GRCm39) V1217A probably damaging Het
Mtss1 A T 15: 58,842,858 (GRCm39) V118E possibly damaging Het
Mug1 T A 6: 121,850,593 (GRCm39) D696E probably benign Het
Ndufa3 C T 7: 3,623,003 (GRCm39) P56L probably damaging Het
Nop56 T A 2: 130,120,205 (GRCm39) C471S possibly damaging Het
Obscn T A 11: 58,891,652 (GRCm39) H6960L unknown Het
Or13a22 C T 7: 140,073,049 (GRCm39) T166I probably benign Het
Pcdhb10 A C 18: 37,546,619 (GRCm39) Q565P probably benign Het
Pde6g T A 11: 120,338,953 (GRCm39) H79L possibly damaging Het
Phrf1 G T 7: 140,836,524 (GRCm39) M265I unknown Het
Pkd2 T C 5: 104,630,986 (GRCm39) F470S probably damaging Het
Plekhm1 T A 11: 103,271,153 (GRCm39) D446V probably damaging Het
Prkaca A T 8: 84,721,963 (GRCm39) T325S probably benign Het
Proz A T 8: 13,111,027 (GRCm39) probably benign Het
Pten T C 19: 32,792,894 (GRCm39) F238L probably benign Het
Ptpn21 G A 12: 98,671,435 (GRCm39) L198F probably damaging Het
Rbm5 A T 9: 107,628,930 (GRCm39) S394T probably benign Het
Scaf8 T G 17: 3,227,994 (GRCm39) S408A unknown Het
Slc41a3 T A 6: 90,617,909 (GRCm39) F312I probably damaging Het
Soat2 T A 15: 102,059,598 (GRCm39) probably null Het
Sorcs1 C A 19: 50,218,698 (GRCm39) G595* probably null Het
Spopfm1 G C 3: 94,173,154 (GRCm39) S50T probably benign Het
Stox1 G T 10: 62,500,723 (GRCm39) D612E probably benign Het
Suco T C 1: 161,665,365 (GRCm39) I530M possibly damaging Het
Syne2 A G 12: 76,030,501 (GRCm39) probably null Het
Thbd G A 2: 148,249,664 (GRCm39) A68V probably damaging Het
Tmem109 A T 19: 10,855,466 (GRCm39) M4K unknown Het
Tmub1 G C 5: 24,651,664 (GRCm39) P85R possibly damaging Het
Tnk2 A C 16: 32,500,053 (GRCm39) Q1039H probably damaging Het
Tpm3 T C 3: 89,993,775 (GRCm39) L89S probably damaging Het
Unc13b C T 4: 43,232,573 (GRCm39) R432* probably null Het
Vmn2r59 T A 7: 41,661,707 (GRCm39) I703F probably damaging Het
Xylt1 T A 7: 117,074,749 (GRCm39) I122N probably benign Het
Zc3h12c T C 9: 52,055,248 (GRCm39) E187G probably damaging Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9,247,443 (GRCm39) missense probably benign 0.24
IGL00481:Abca13 APN 11 9,240,969 (GRCm39) missense probably damaging 0.99
IGL00707:Abca13 APN 11 9,241,586 (GRCm39) missense probably damaging 0.99
IGL00755:Abca13 APN 11 9,492,102 (GRCm39) missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9,240,870 (GRCm39) missense probably damaging 1.00
IGL00802:Abca13 APN 11 9,247,717 (GRCm39) missense probably damaging 0.96
IGL00807:Abca13 APN 11 9,328,285 (GRCm39) missense probably benign 0.10
IGL00977:Abca13 APN 11 9,349,284 (GRCm39) missense probably damaging 1.00
IGL01064:Abca13 APN 11 9,433,855 (GRCm39) missense probably benign 0.01
IGL01100:Abca13 APN 11 9,224,673 (GRCm39) splice site probably null
IGL01290:Abca13 APN 11 9,206,232 (GRCm39) missense probably damaging 1.00
IGL01299:Abca13 APN 11 9,248,743 (GRCm39) missense probably benign 0.22
IGL01302:Abca13 APN 11 9,349,470 (GRCm39) splice site probably benign
IGL01307:Abca13 APN 11 9,247,159 (GRCm39) missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9,242,076 (GRCm39) missense probably benign 0.05
IGL01351:Abca13 APN 11 9,217,565 (GRCm39) missense probably benign 0.28
IGL01446:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01453:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01461:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01476:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01506:Abca13 APN 11 9,247,447 (GRCm39) missense probably benign 0.36
IGL01527:Abca13 APN 11 9,240,788 (GRCm39) missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9,259,020 (GRCm39) missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9,243,527 (GRCm39) missense probably benign 0.00
IGL01679:Abca13 APN 11 9,248,071 (GRCm39) missense probably benign 0.07
IGL01731:Abca13 APN 11 9,199,749 (GRCm39) splice site probably benign
IGL01762:Abca13 APN 11 9,265,423 (GRCm39) missense probably benign 0.18
IGL01781:Abca13 APN 11 9,349,280 (GRCm39) missense probably damaging 1.00
IGL01802:Abca13 APN 11 9,242,438 (GRCm39) missense probably benign 0.00
IGL01809:Abca13 APN 11 9,240,339 (GRCm39) missense probably damaging 0.96
IGL01906:Abca13 APN 11 9,166,225 (GRCm39) missense probably damaging 1.00
IGL01928:Abca13 APN 11 9,633,342 (GRCm39) missense probably benign 0.13
IGL01940:Abca13 APN 11 9,517,661 (GRCm39) splice site probably benign
IGL01993:Abca13 APN 11 9,208,452 (GRCm39) unclassified probably benign
IGL02039:Abca13 APN 11 9,247,193 (GRCm39) nonsense probably null
IGL02159:Abca13 APN 11 9,264,545 (GRCm39) missense probably benign 0.00
IGL02202:Abca13 APN 11 9,238,529 (GRCm39) missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9,240,626 (GRCm39) missense probably benign 0.00
IGL02332:Abca13 APN 11 9,241,482 (GRCm39) missense probably damaging 0.98
IGL02380:Abca13 APN 11 9,241,599 (GRCm39) missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9,247,527 (GRCm39) missense probably benign 0.00
IGL02505:Abca13 APN 11 9,531,498 (GRCm39) missense probably damaging 1.00
IGL02507:Abca13 APN 11 9,349,388 (GRCm39) missense probably damaging 1.00
IGL02558:Abca13 APN 11 9,349,387 (GRCm39) missense probably damaging 1.00
IGL02581:Abca13 APN 11 9,349,132 (GRCm39) splice site probably benign
IGL02586:Abca13 APN 11 9,243,983 (GRCm39) missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9,381,898 (GRCm39) missense probably damaging 1.00
IGL02747:Abca13 APN 11 9,323,282 (GRCm39) nonsense probably null
IGL02893:Abca13 APN 11 9,240,543 (GRCm39) missense probably damaging 0.96
IGL02930:Abca13 APN 11 9,328,226 (GRCm39) missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9,328,291 (GRCm39) missense probably damaging 0.99
IGL02983:Abca13 APN 11 9,240,663 (GRCm39) missense probably benign 0.40
IGL02999:Abca13 APN 11 9,531,757 (GRCm39) splice site probably benign
IGL03100:Abca13 APN 11 9,208,527 (GRCm39) missense probably benign 0.25
IGL03114:Abca13 APN 11 9,478,999 (GRCm39) missense probably benign 0.06
IGL03230:Abca13 APN 11 9,244,313 (GRCm39) missense probably benign 0.02
IGL03329:Abca13 APN 11 9,248,047 (GRCm39) missense probably benign 0.08
IGL03380:Abca13 APN 11 9,248,574 (GRCm39) missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9,401,515 (GRCm39) missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9,244,962 (GRCm39) missense probably benign
PIT4458001:Abca13 UTSW 11 9,248,304 (GRCm39) missense probably benign 0.05
R0017:Abca13 UTSW 11 9,242,775 (GRCm39) missense probably damaging 0.99
R0079:Abca13 UTSW 11 9,243,493 (GRCm39) missense probably benign 0.00
R0089:Abca13 UTSW 11 9,242,886 (GRCm39) missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0113:Abca13 UTSW 11 9,242,114 (GRCm39) missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0152:Abca13 UTSW 11 9,531,724 (GRCm39) missense probably damaging 0.98
R0255:Abca13 UTSW 11 9,531,545 (GRCm39) missense probably damaging 1.00
R0277:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0278:Abca13 UTSW 11 9,328,215 (GRCm39) missense probably damaging 1.00
R0294:Abca13 UTSW 11 9,219,122 (GRCm39) splice site probably null
R0299:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0310:Abca13 UTSW 11 9,243,810 (GRCm39) missense probably benign 0.36
R0317:Abca13 UTSW 11 9,243,459 (GRCm39) missense probably damaging 1.00
R0323:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0324:Abca13 UTSW 11 9,247,669 (GRCm39) missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9,349,430 (GRCm39) missense probably damaging 0.97
R0336:Abca13 UTSW 11 9,248,481 (GRCm39) missense probably benign 0.04
R0346:Abca13 UTSW 11 9,516,278 (GRCm39) missense probably damaging 0.99
R0380:Abca13 UTSW 11 9,538,500 (GRCm39) splice site probably null
R0382:Abca13 UTSW 11 9,586,650 (GRCm39) splice site probably benign
R0482:Abca13 UTSW 11 9,278,207 (GRCm39) missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9,281,687 (GRCm39) missense probably benign 0.07
R0491:Abca13 UTSW 11 9,248,235 (GRCm39) missense probably benign 0.02
R0496:Abca13 UTSW 11 9,241,701 (GRCm39) missense probably benign 0.01
R0505:Abca13 UTSW 11 9,241,058 (GRCm39) missense probably benign 0.00
R0511:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign
R0525:Abca13 UTSW 11 9,243,371 (GRCm39) missense probably damaging 1.00
R0538:Abca13 UTSW 11 9,217,622 (GRCm39) critical splice donor site probably null
R0615:Abca13 UTSW 11 9,206,197 (GRCm39) missense probably damaging 0.96
R0634:Abca13 UTSW 11 9,264,491 (GRCm39) missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9,538,508 (GRCm39) splice site probably benign
R0848:Abca13 UTSW 11 9,632,011 (GRCm39) nonsense probably null
R0883:Abca13 UTSW 11 9,241,238 (GRCm39) nonsense probably null
R0892:Abca13 UTSW 11 9,248,305 (GRCm39) missense probably benign 0.00
R0904:Abca13 UTSW 11 9,248,740 (GRCm39) missense probably benign 0.22
R0968:Abca13 UTSW 11 9,248,016 (GRCm39) missense probably benign 0.00
R1187:Abca13 UTSW 11 9,478,981 (GRCm39) missense probably benign 0.00
R1299:Abca13 UTSW 11 9,244,821 (GRCm39) missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9,241,836 (GRCm39) missense probably benign
R1387:Abca13 UTSW 11 9,632,085 (GRCm39) nonsense probably null
R1436:Abca13 UTSW 11 9,242,646 (GRCm39) missense probably damaging 0.99
R1449:Abca13 UTSW 11 9,248,580 (GRCm39) missense probably damaging 1.00
R1450:Abca13 UTSW 11 9,380,531 (GRCm39) splice site probably benign
R1462:Abca13 UTSW 11 9,433,924 (GRCm39) splice site probably benign
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1466:Abca13 UTSW 11 9,520,536 (GRCm39) splice site probably benign
R1494:Abca13 UTSW 11 9,416,429 (GRCm39) nonsense probably null
R1559:Abca13 UTSW 11 9,349,180 (GRCm39) missense probably null 1.00
R1564:Abca13 UTSW 11 9,384,316 (GRCm39) nonsense probably null
R1698:Abca13 UTSW 11 9,264,507 (GRCm39) missense probably benign 0.13
R1728:Abca13 UTSW 11 9,199,680 (GRCm39) missense probably benign 0.02
R1734:Abca13 UTSW 11 9,535,460 (GRCm39) missense probably benign 0.03
R1781:Abca13 UTSW 11 9,219,194 (GRCm39) missense probably damaging 1.00
R1782:Abca13 UTSW 11 9,247,971 (GRCm39) missense probably benign 0.36
R1807:Abca13 UTSW 11 9,241,755 (GRCm39) missense probably damaging 0.98
R1830:Abca13 UTSW 11 9,240,350 (GRCm39) missense probably benign 0.04
R1869:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1870:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1871:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1903:Abca13 UTSW 11 9,416,411 (GRCm39) missense probably benign 0.13
R1916:Abca13 UTSW 11 9,484,456 (GRCm39) missense probably damaging 1.00
R1936:Abca13 UTSW 11 9,243,595 (GRCm39) missense probably benign 0.13
R1976:Abca13 UTSW 11 9,347,815 (GRCm39) missense probably damaging 1.00
R2001:Abca13 UTSW 11 9,223,967 (GRCm39) missense probably benign 0.01
R2007:Abca13 UTSW 11 9,141,987 (GRCm39) missense probably benign 0.19
R2016:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2017:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2034:Abca13 UTSW 11 9,242,628 (GRCm39) missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9,278,098 (GRCm39) missense probably benign 0.04
R2075:Abca13 UTSW 11 9,472,382 (GRCm39) missense probably damaging 1.00
R2118:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2120:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2124:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2148:Abca13 UTSW 11 9,565,764 (GRCm39) missense probably damaging 1.00
R2149:Abca13 UTSW 11 9,217,508 (GRCm39) missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9,527,170 (GRCm39) missense probably damaging 0.97
R2167:Abca13 UTSW 11 9,238,532 (GRCm39) missense probably benign 0.19
R2261:Abca13 UTSW 11 9,242,288 (GRCm39) missense probably benign
R2263:Abca13 UTSW 11 9,224,702 (GRCm39) missense probably benign 0.04
R2281:Abca13 UTSW 11 9,278,136 (GRCm39) missense probably damaging 0.98
R2340:Abca13 UTSW 11 9,349,165 (GRCm39) missense probably damaging 0.99
R2357:Abca13 UTSW 11 9,247,336 (GRCm39) missense probably damaging 1.00
R2370:Abca13 UTSW 11 9,206,185 (GRCm39) missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9,217,450 (GRCm39) splice site probably benign
R2393:Abca13 UTSW 11 9,225,057 (GRCm39) nonsense probably null
R2432:Abca13 UTSW 11 9,401,333 (GRCm39) splice site probably benign
R2446:Abca13 UTSW 11 9,225,101 (GRCm39) missense probably benign
R2568:Abca13 UTSW 11 9,283,310 (GRCm39) missense probably benign 0.40
R2847:Abca13 UTSW 11 9,244,584 (GRCm39) missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2861:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2862:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2877:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9,266,119 (GRCm39) splice site probably benign
R3789:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R3933:Abca13 UTSW 11 9,304,856 (GRCm39) missense probably damaging 1.00
R3981:Abca13 UTSW 11 9,482,407 (GRCm39) missense probably benign
R4002:Abca13 UTSW 11 9,535,415 (GRCm39) missense probably benign 0.00
R4010:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4011:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4127:Abca13 UTSW 11 9,141,973 (GRCm39) missense probably benign 0.00
R4214:Abca13 UTSW 11 9,243,877 (GRCm39) missense probably damaging 0.96
R4236:Abca13 UTSW 11 9,206,205 (GRCm39) missense probably damaging 1.00
R4237:Abca13 UTSW 11 9,384,188 (GRCm39) missense probably benign 0.01
R4359:Abca13 UTSW 11 9,247,629 (GRCm39) missense probably benign 0.02
R4378:Abca13 UTSW 11 9,243,644 (GRCm39) missense probably benign 0.00
R4389:Abca13 UTSW 11 9,247,878 (GRCm39) missense probably damaging 0.98
R4392:Abca13 UTSW 11 9,259,034 (GRCm39) missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9,259,130 (GRCm39) missense probably damaging 1.00
R4684:Abca13 UTSW 11 9,384,193 (GRCm39) nonsense probably null
R4691:Abca13 UTSW 11 9,384,195 (GRCm39) missense probably damaging 1.00
R4700:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9,226,990 (GRCm39) missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9,227,973 (GRCm39) critical splice donor site probably null
R4772:Abca13 UTSW 11 9,265,339 (GRCm39) splice site probably null
R4782:Abca13 UTSW 11 9,278,096 (GRCm39) missense probably damaging 0.96
R4801:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9,492,077 (GRCm39) nonsense probably null
R4851:Abca13 UTSW 11 9,433,890 (GRCm39) missense probably benign 0.02
R4857:Abca13 UTSW 11 9,244,143 (GRCm39) missense probably benign 0.22
R4869:Abca13 UTSW 11 9,265,434 (GRCm39) splice site probably null
R4982:Abca13 UTSW 11 9,242,348 (GRCm39) missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9,247,678 (GRCm39) missense probably damaging 0.99
R5044:Abca13 UTSW 11 9,323,323 (GRCm39) missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9,208,535 (GRCm39) missense probably damaging 1.00
R5155:Abca13 UTSW 11 9,482,447 (GRCm39) missense probably damaging 0.98
R5173:Abca13 UTSW 11 9,632,032 (GRCm39) frame shift probably null
R5180:Abca13 UTSW 11 9,416,510 (GRCm39) missense probably benign 0.01
R5244:Abca13 UTSW 11 9,225,081 (GRCm39) missense probably benign 0.28
R5257:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9,381,861 (GRCm39) missense probably damaging 1.00
R5363:Abca13 UTSW 11 9,227,035 (GRCm39) missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9,578,629 (GRCm39) missense probably damaging 1.00
R5419:Abca13 UTSW 11 9,143,533 (GRCm39) critical splice donor site probably null
R5426:Abca13 UTSW 11 9,240,722 (GRCm39) missense probably damaging 1.00
R5468:Abca13 UTSW 11 9,244,062 (GRCm39) missense probably damaging 1.00
R5477:Abca13 UTSW 11 9,251,298 (GRCm39) missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.00
R5553:Abca13 UTSW 11 9,278,158 (GRCm39) missense probably damaging 1.00
R5556:Abca13 UTSW 11 9,208,546 (GRCm39) missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9,244,615 (GRCm39) nonsense probably null
R5582:Abca13 UTSW 11 9,586,639 (GRCm39) splice site probably null
R5604:Abca13 UTSW 11 9,516,279 (GRCm39) missense probably damaging 0.97
R5609:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R5617:Abca13 UTSW 11 9,227,891 (GRCm39) missense probably benign 0.00
R5693:Abca13 UTSW 11 9,266,233 (GRCm39) missense probably benign 0.29
R5707:Abca13 UTSW 11 9,460,620 (GRCm39) missense probably damaging 1.00
R5725:Abca13 UTSW 11 9,527,181 (GRCm39) missense probably benign 0.00
R5728:Abca13 UTSW 11 9,520,576 (GRCm39) missense probably damaging 1.00
R5738:Abca13 UTSW 11 9,571,917 (GRCm39) missense probably damaging 1.00
R5758:Abca13 UTSW 11 9,264,536 (GRCm39) missense probably damaging 0.97
R5762:Abca13 UTSW 11 9,531,665 (GRCm39) missense probably damaging 1.00
R5771:Abca13 UTSW 11 9,241,411 (GRCm39) missense probably damaging 1.00
R5809:Abca13 UTSW 11 9,243,692 (GRCm39) missense probably damaging 1.00
R5826:Abca13 UTSW 11 9,632,056 (GRCm39) missense probably damaging 0.99
R5831:Abca13 UTSW 11 9,517,777 (GRCm39) nonsense probably null
R5834:Abca13 UTSW 11 9,227,974 (GRCm39) critical splice donor site probably null
R5902:Abca13 UTSW 11 9,247,177 (GRCm39) missense probably damaging 1.00
R5933:Abca13 UTSW 11 9,199,658 (GRCm39) missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9,243,398 (GRCm39) missense probably benign 0.04
R5969:Abca13 UTSW 11 9,242,214 (GRCm39) nonsense probably null
R5985:Abca13 UTSW 11 9,241,628 (GRCm39) missense probably benign 0.02
R5998:Abca13 UTSW 11 9,517,708 (GRCm39) missense probably damaging 0.97
R6021:Abca13 UTSW 11 9,240,465 (GRCm39) nonsense probably null
R6022:Abca13 UTSW 11 9,240,759 (GRCm39) missense probably damaging 1.00
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9,347,812 (GRCm39) missense probably damaging 1.00
R6153:Abca13 UTSW 11 9,251,259 (GRCm39) critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9,259,047 (GRCm39) missense probably damaging 1.00
R6187:Abca13 UTSW 11 9,259,085 (GRCm39) missense probably damaging 1.00
R6247:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R6329:Abca13 UTSW 11 9,227,937 (GRCm39) missense probably damaging 1.00
R6352:Abca13 UTSW 11 9,259,139 (GRCm39) splice site probably null
R6367:Abca13 UTSW 11 9,166,248 (GRCm39) missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9,248,778 (GRCm39) missense probably benign 0.01
R6424:Abca13 UTSW 11 9,460,542 (GRCm39) missense probably benign
R6456:Abca13 UTSW 11 9,240,474 (GRCm39) missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9,248,661 (GRCm39) missense probably benign 0.00
R6547:Abca13 UTSW 11 9,224,757 (GRCm39) missense probably benign 0.04
R6594:Abca13 UTSW 11 9,244,632 (GRCm39) missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9,328,384 (GRCm39) missense probably damaging 1.00
R6614:Abca13 UTSW 11 9,244,371 (GRCm39) missense probably benign 0.04
R6736:Abca13 UTSW 11 9,415,058 (GRCm39) missense probably damaging 1.00
R6742:Abca13 UTSW 11 9,278,168 (GRCm39) missense probably damaging 1.00
R6791:Abca13 UTSW 11 9,328,504 (GRCm39) missense probably damaging 1.00
R6834:Abca13 UTSW 11 9,225,110 (GRCm39) missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9,248,568 (GRCm39) missense probably damaging 0.96
R6955:Abca13 UTSW 11 9,244,307 (GRCm39) missense probably benign 0.28
R7031:Abca13 UTSW 11 9,571,892 (GRCm39) missense probably damaging 1.00
R7065:Abca13 UTSW 11 9,242,595 (GRCm39) missense probably benign 0.02
R7067:Abca13 UTSW 11 9,241,845 (GRCm39) missense probably benign 0.14
R7070:Abca13 UTSW 11 9,240,701 (GRCm39) missense probably benign 0.06
R7094:Abca13 UTSW 11 9,248,610 (GRCm39) missense probably damaging 0.96
R7102:Abca13 UTSW 11 9,285,215 (GRCm39) missense probably damaging 1.00
R7105:Abca13 UTSW 11 9,347,842 (GRCm39) missense probably damaging 1.00
R7131:Abca13 UTSW 11 9,241,893 (GRCm39) missense probably benign 0.37
R7155:Abca13 UTSW 11 9,479,010 (GRCm39) missense probably benign
R7158:Abca13 UTSW 11 9,223,982 (GRCm39) missense probably benign
R7212:Abca13 UTSW 11 9,248,854 (GRCm39) missense probably benign 0.04
R7215:Abca13 UTSW 11 9,238,405 (GRCm39) splice site probably null
R7228:Abca13 UTSW 11 9,247,653 (GRCm39) missense probably benign
R7231:Abca13 UTSW 11 9,244,175 (GRCm39) missense probably benign 0.25
R7247:Abca13 UTSW 11 9,240,732 (GRCm39) missense probably benign 0.00
R7278:Abca13 UTSW 11 9,241,126 (GRCm39) missense possibly damaging 0.56
R7299:Abca13 UTSW 11 9,244,649 (GRCm39) missense probably damaging 0.98
R7304:Abca13 UTSW 11 9,247,203 (GRCm39) missense probably benign
R7328:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.14
R7374:Abca13 UTSW 11 9,242,136 (GRCm39) missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9,241,118 (GRCm39) missense probably benign 0.00
R7384:Abca13 UTSW 11 9,283,257 (GRCm39) missense probably damaging 1.00
R7395:Abca13 UTSW 11 9,241,658 (GRCm39) missense probably benign 0.01
R7419:Abca13 UTSW 11 9,247,833 (GRCm39) missense probably damaging 1.00
R7419:Abca13 UTSW 11 9,226,959 (GRCm39) missense probably damaging 1.00
R7421:Abca13 UTSW 11 9,460,463 (GRCm39) missense probably benign
R7458:Abca13 UTSW 11 9,240,777 (GRCm39) missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9,278,088 (GRCm39) nonsense probably null
R7492:Abca13 UTSW 11 9,243,167 (GRCm39) missense probably benign 0.08
R7660:Abca13 UTSW 11 9,240,678 (GRCm39) missense probably benign 0.00
R7677:Abca13 UTSW 11 9,248,349 (GRCm39) nonsense probably null
R7744:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9,247,915 (GRCm39) missense probably damaging 1.00
R7798:Abca13 UTSW 11 9,241,664 (GRCm39) missense probably benign 0.04
R7811:Abca13 UTSW 11 9,527,141 (GRCm39) splice site probably null
R7831:Abca13 UTSW 11 9,247,404 (GRCm39) missense possibly damaging 0.46
R7910:Abca13 UTSW 11 9,531,590 (GRCm39) missense probably damaging 1.00
R7964:Abca13 UTSW 11 9,266,146 (GRCm39) missense probably benign 0.06
R8037:Abca13 UTSW 11 9,243,904 (GRCm39) missense probably damaging 1.00
R8049:Abca13 UTSW 11 9,241,867 (GRCm39) missense probably damaging 0.99
R8059:Abca13 UTSW 11 9,323,279 (GRCm39) missense probably benign 0.00
R8072:Abca13 UTSW 11 9,244,574 (GRCm39) missense probably benign 0.10
R8078:Abca13 UTSW 11 9,251,279 (GRCm39) missense probably benign 0.32
R8112:Abca13 UTSW 11 9,264,624 (GRCm39) missense probably benign 0.01
R8146:Abca13 UTSW 11 9,347,829 (GRCm39) missense probably damaging 1.00
R8164:Abca13 UTSW 11 9,565,799 (GRCm39) missense probably damaging 1.00
R8195:Abca13 UTSW 11 9,224,735 (GRCm39) missense probably benign 0.00
R8220:Abca13 UTSW 11 9,384,299 (GRCm39) missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9,212,077 (GRCm39) missense probably damaging 0.99
R8307:Abca13 UTSW 11 9,227,922 (GRCm39) nonsense probably null
R8310:Abca13 UTSW 11 9,328,269 (GRCm39) missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9,535,502 (GRCm39) missense probably benign 0.44
R8315:Abca13 UTSW 11 9,328,460 (GRCm39) missense probably null 1.00
R8324:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,347,841 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,265,416 (GRCm39) missense probably benign 0.00
R8400:Abca13 UTSW 11 9,248,218 (GRCm39) missense probably damaging 0.97
R8400:Abca13 UTSW 11 9,243,925 (GRCm39) missense probably benign 0.00
R8425:Abca13 UTSW 11 9,264,623 (GRCm39) missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9,225,092 (GRCm39) missense probably benign 0.00
R8493:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R8502:Abca13 UTSW 11 9,219,282 (GRCm39) missense probably benign 0.02
R8716:Abca13 UTSW 11 9,243,774 (GRCm39) missense probably benign 0.09
R8787:Abca13 UTSW 11 9,225,053 (GRCm39) missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9,571,881 (GRCm39) missense probably damaging 1.00
R8859:Abca13 UTSW 11 9,328,397 (GRCm39) missense
R8871:Abca13 UTSW 11 9,248,071 (GRCm39) missense probably benign 0.07
R8883:Abca13 UTSW 11 9,283,168 (GRCm39) missense probably benign 0.00
R8919:Abca13 UTSW 11 9,241,653 (GRCm39) missense possibly damaging 0.84
R8966:Abca13 UTSW 11 9,578,588 (GRCm39) missense probably damaging 1.00
R8967:Abca13 UTSW 11 9,242,696 (GRCm39) missense probably benign 0.18
R8969:Abca13 UTSW 11 9,227,944 (GRCm39) missense probably benign
R8972:Abca13 UTSW 11 9,278,138 (GRCm39) missense probably damaging 1.00
R9002:Abca13 UTSW 11 9,241,926 (GRCm39) missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9,243,525 (GRCm39) missense probably benign 0.04
R9051:Abca13 UTSW 11 9,285,232 (GRCm39) missense probably damaging 1.00
R9056:Abca13 UTSW 11 9,414,921 (GRCm39) missense probably damaging 1.00
R9061:Abca13 UTSW 11 9,227,847 (GRCm39) missense probably benign 0.02
R9072:Abca13 UTSW 11 9,240,834 (GRCm39) missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9127:Abca13 UTSW 11 9,242,080 (GRCm39) missense probably benign 0.03
R9164:Abca13 UTSW 11 9,278,157 (GRCm39) missense probably damaging 1.00
R9175:Abca13 UTSW 11 9,531,593 (GRCm39) missense probably damaging 0.98
R9190:Abca13 UTSW 11 9,241,886 (GRCm39) missense probably damaging 0.96
R9244:Abca13 UTSW 11 9,241,577 (GRCm39) missense probably benign 0.01
R9255:Abca13 UTSW 11 9,278,213 (GRCm39) missense probably damaging 1.00
R9271:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9321:Abca13 UTSW 11 9,460,475 (GRCm39) missense probably benign 0.00
R9356:Abca13 UTSW 11 9,206,305 (GRCm39) missense probably benign 0.11
R9369:Abca13 UTSW 11 9,328,444 (GRCm39) missense probably damaging 1.00
R9423:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R9432:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign 0.00
R9455:Abca13 UTSW 11 9,353,897 (GRCm39) missense probably damaging 1.00
R9486:Abca13 UTSW 11 9,240,621 (GRCm39) missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9,243,667 (GRCm39) nonsense probably null
R9511:Abca13 UTSW 11 9,278,130 (GRCm39) missense probably benign 0.16
R9545:Abca13 UTSW 11 9,416,538 (GRCm39) missense probably damaging 1.00
R9566:Abca13 UTSW 11 9,414,927 (GRCm39) missense probably damaging 1.00
R9609:Abca13 UTSW 11 9,208,549 (GRCm39) missense probably damaging 1.00
R9616:Abca13 UTSW 11 9,240,501 (GRCm39) missense probably benign 0.00
R9651:Abca13 UTSW 11 9,535,484 (GRCm39) missense probably benign
R9651:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9653:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9657:Abca13 UTSW 11 9,243,379 (GRCm39) missense probably benign 0.35
R9684:Abca13 UTSW 11 9,283,307 (GRCm39) missense probably damaging 1.00
X0013:Abca13 UTSW 11 9,223,899 (GRCm39) missense probably benign 0.02
X0057:Abca13 UTSW 11 9,244,744 (GRCm39) missense probably damaging 0.96
X0066:Abca13 UTSW 11 9,217,565 (GRCm39) missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9,244,687 (GRCm39) missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9,217,461 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,201,376 (GRCm39) missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9,285,182 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,285,181 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,244,342 (GRCm39) missense probably benign 0.01
Z1177:Abca13 UTSW 11 9,264,545 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCAAATGGTATTCAATGGTGATTAGG -3'
(R):5'- AGCAGATTTCACCTTTCTAGCTAC -3'

Sequencing Primer
(F):5'- AATATCGTCTGGGATCCC -3'
(R):5'- GCTTGCCCCAGTGATATACAG -3'
Posted On 2019-12-20