Incidental Mutation 'R7867:Akap10'
ID607856
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R7867 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61900446 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 396 (Y396H)
Ref Sequence ENSEMBL: ENSMUSP00000099710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058173] [ENSMUST00000102650] [ENSMUST00000108710]
Predicted Effect probably damaging
Transcript: ENSMUST00000058173
AA Change: Y317H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804
AA Change: Y317H

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102650
AA Change: Y396H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: Y396H

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108710
AA Change: Y396H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: Y396H

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cnn3 A G 3: 121,455,055 I204V probably benign Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Mug1 T A 6: 121,873,634 D696E probably benign Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Prkaca A T 8: 83,995,334 T325S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Pten T C 19: 32,815,494 F238L probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Syne2 A G 12: 75,983,727 probably null Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7986:Akap10 UTSW 11 61930064 missense probably damaging 1.00
R8079:Akap10 UTSW 11 61930054 missense possibly damaging 0.93
Z1186:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1187:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1188:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1189:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1190:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1191:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1192:Akap10 UTSW 11 61915270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCAGTGCATATAGTGAATGCTC -3'
(R):5'- TGCACTGAAGTTTGCATCTCC -3'

Sequencing Primer
(F):5'- GTGAATGCTCAGAACAACTCACTTG -3'
(R):5'- ACTGAAGTTTGCATCTCCTGGTAC -3'
Posted On2019-12-20