Incidental Mutation 'R0200:Senp7'
ID60786
Institutional Source Beutler Lab
Gene Symbol Senp7
Ensembl Gene ENSMUSG00000052917
Gene NameSUMO1/sentrin specific peptidase 7
Synonyms
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0200 (G1)
Quality Score158
Status Not validated
Chromosome16
Chromosomal Location56048338-56190012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56123873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000043023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049128] [ENSMUST00000089360] [ENSMUST00000089362] [ENSMUST00000201011] [ENSMUST00000202000] [ENSMUST00000202799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049128
AA Change: T187A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043023
Gene: ENSMUSG00000052917
AA Change: T187A

DomainStartEndE-ValueType
internal_repeat_1 86 118 1.08e-5 PROSPERO
internal_repeat_1 152 184 1.08e-5 PROSPERO
low complexity region 192 208 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089360
AA Change: T160A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086776
Gene: ENSMUSG00000052917
AA Change: T160A

DomainStartEndE-ValueType
low complexity region 165 181 N/A INTRINSIC
low complexity region 352 376 N/A INTRINSIC
low complexity region 386 395 N/A INTRINSIC
low complexity region 639 646 N/A INTRINSIC
Pfam:Peptidase_C48 734 999 7.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089362
AA Change: T187A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086779
Gene: ENSMUSG00000052917
AA Change: T187A

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 666 673 N/A INTRINSIC
Pfam:Peptidase_C48 761 1026 8.5e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201011
AA Change: T160A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201915
Predicted Effect possibly damaging
Transcript: ENSMUST00000202000
AA Change: T187A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144116
Gene: ENSMUSG00000052917
AA Change: T187A

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202799
AA Change: T160A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144348
Gene: ENSMUSG00000052917
AA Change: T160A

DomainStartEndE-ValueType
internal_repeat_1 59 91 2.07e-5 PROSPERO
internal_repeat_1 125 157 2.07e-5 PROSPERO
low complexity region 165 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a SUMO deconjugating enzyme of the Sentrin/SUMO-specific protease (SENP) family. The encoded protein is a protease that exhibits deSUMOylating activity towards proteins involved in chromatin remodeling and promotes chromatin relaxation for DNA repair or transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Senp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Senp7 APN 16 56082377 missense probably damaging 0.96
IGL01610:Senp7 APN 16 56175823 missense possibly damaging 0.94
IGL01627:Senp7 APN 16 56171856 missense probably damaging 1.00
IGL02748:Senp7 APN 16 56186094 missense probably damaging 1.00
IGL03031:Senp7 APN 16 56175886 missense probably damaging 1.00
IGL03083:Senp7 APN 16 56171865 missense probably benign 0.28
R0034:Senp7 UTSW 16 56153570 missense possibly damaging 0.63
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0547:Senp7 UTSW 16 56175826 missense probably damaging 1.00
R0608:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R1595:Senp7 UTSW 16 56184768 missense probably damaging 1.00
R1737:Senp7 UTSW 16 56123799 missense probably damaging 1.00
R1837:Senp7 UTSW 16 56158516 missense probably benign 0.01
R1945:Senp7 UTSW 16 56123946 missense probably damaging 0.98
R2143:Senp7 UTSW 16 56169806 missense probably benign
R2275:Senp7 UTSW 16 56184783 missense probably damaging 1.00
R2508:Senp7 UTSW 16 56151362 missense probably benign 0.28
R3404:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3405:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3717:Senp7 UTSW 16 56179057 splice site probably benign
R3885:Senp7 UTSW 16 56186079 missense probably damaging 1.00
R4159:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4160:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4161:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4512:Senp7 UTSW 16 56165883 missense probably damaging 1.00
R5291:Senp7 UTSW 16 56186179 nonsense probably null
R5315:Senp7 UTSW 16 56180526 missense probably benign 0.26
R5390:Senp7 UTSW 16 56169916 missense probably benign
R5424:Senp7 UTSW 16 56186108 missense possibly damaging 0.82
R5643:Senp7 UTSW 16 56184149 splice site silent
R5644:Senp7 UTSW 16 56184149 splice site silent
R5645:Senp7 UTSW 16 56173208 missense possibly damaging 0.80
R5799:Senp7 UTSW 16 56139105 splice site probably null
R5860:Senp7 UTSW 16 56155359 missense possibly damaging 0.49
R5954:Senp7 UTSW 16 56169871 missense probably benign 0.04
R6164:Senp7 UTSW 16 56169754 missense probably damaging 1.00
R6280:Senp7 UTSW 16 56162375 missense possibly damaging 0.62
R6647:Senp7 UTSW 16 56173255 missense probably damaging 1.00
R6652:Senp7 UTSW 16 56123894 missense probably benign 0.08
R7310:Senp7 UTSW 16 56186082 missense probably benign 0.18
R7460:Senp7 UTSW 16 56173182 missense possibly damaging 0.65
R7480:Senp7 UTSW 16 56155226 missense possibly damaging 0.80
U24488:Senp7 UTSW 16 56184819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTTGATTCCCTGAATGCTACGATCC -3'
(R):5'- ACTGCTGCTTCCAAAAGACATCCTATG -3'

Sequencing Primer
(F):5'- CCTGAATGCTACGATCCTAATAAAG -3'
(R):5'- TATGGGCAAAAGTCACACTAGC -3'
Posted On2013-07-24