Incidental Mutation 'R7867:Pten'
ID607882
Institutional Source Beutler Lab
Gene Symbol Pten
Ensembl Gene ENSMUSG00000013663
Gene Namephosphatase and tensin homolog
SynonymsA130070J02Rik, 2310035O07Rik, B430203M17Rik, MMAC1, TEP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7867 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location32757497-32826160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32815494 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000013807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013807]
Predicted Effect probably benign
Transcript: ENSMUST00000013807
AA Change: F238L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013807
Gene: ENSMUSG00000013663
AA Change: F238L

DomainStartEndE-ValueType
Pfam:Y_phosphatase 42 183 2.7e-6 PFAM
Pfam:DSPc 67 173 2.4e-9 PFAM
PTEN_C2 188 349 4.07e-49 SMART
low complexity region 360 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a phosphatase with dual activity against phospholipids and proteins, and acts as a tumor-suppressor. The protein contains four structural domains, a PIP2-binding domain, a catalytic tensin-type phosphatase domain, a C2 tensin-type domain and a PDZ-binding domain. The protein belongs to the protein tyrosine phosphatase family. Deletion of this gene in mice contribute to tumorigenesis in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die by E9.5 with abnormally patterned enlarged brains and defective placentas. Heterozygotes develop a range of neoplasms. Conditional mutants demonstrate effects on basic processes of proliferation, differentiation and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Akap10 A G 11: 61,900,446 Y396H probably damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cnn3 A G 3: 121,455,055 I204V probably benign Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Mug1 T A 6: 121,873,634 D696E probably benign Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Prkaca A T 8: 83,995,334 T325S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Syne2 A G 12: 75,983,727 probably null Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Pten
AlleleSourceChrCoordTypePredicted EffectPPH Score
Brakes UTSW 19 32815497 missense probably benign
Bremse UTSW 19 32800085 missense possibly damaging 0.91
R0131:Pten UTSW 19 32776069 missense probably benign 0.15
R0557:Pten UTSW 19 32817890 missense probably benign
R1387:Pten UTSW 19 32798096 missense probably benign
R1479:Pten UTSW 19 32819850 missense probably damaging 0.99
R1773:Pten UTSW 19 32798072 missense probably damaging 1.00
R4801:Pten UTSW 19 32758503 missense possibly damaging 0.75
R4802:Pten UTSW 19 32758503 missense possibly damaging 0.75
R5196:Pten UTSW 19 32815497 missense probably benign
R5200:Pten UTSW 19 32799891 missense probably damaging 0.97
R5672:Pten UTSW 19 32758466 missense probably benign
R6143:Pten UTSW 19 32800085 missense possibly damaging 0.91
R7644:Pten UTSW 19 32811834 missense probably damaging 1.00
R7849:Pten UTSW 19 32799996 missense probably damaging 1.00
Z1088:Pten UTSW 19 32776051 missense probably damaging 0.96
Z1088:Pten UTSW 19 32799998 missense probably damaging 1.00
Z1176:Pten UTSW 19 32798115 critical splice donor site probably null
Z1177:Pten UTSW 19 32811805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAAGTCCTTACATGGGTTGG -3'
(R):5'- TTTGGTAGATGGCAGAGAAATAGTC -3'

Sequencing Primer
(F):5'- AGAAGTCCTTACATGGGTTGGTTATG -3'
(R):5'- TACAGAATAATTTCCTAACCAAAGGC -3'
Posted On2019-12-20