Incidental Mutation 'R7867:Sorcs1'
ID 607883
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 045919-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7867 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 50218698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 595 (G595*)
Ref Sequence ENSEMBL: ENSMUSP00000147463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000072685
AA Change: G595*
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: G595*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
AA Change: G595*
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: G595*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
AA Change: G595*
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: G595*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
AA Change: G595*
Predicted Effect probably null
Transcript: ENSMUST00000209783
AA Change: G595*
Predicted Effect probably null
Transcript: ENSMUST00000211008
AA Change: G595*
Predicted Effect probably null
Transcript: ENSMUST00000211687
AA Change: G595*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,212,139 (GRCm39) probably null Het
Abcf1 C A 17: 36,272,890 (GRCm39) K252N probably damaging Het
Abi3 C T 11: 95,724,851 (GRCm39) A211T possibly damaging Het
Acaca A T 11: 84,140,350 (GRCm39) D608V possibly damaging Het
Akap10 A G 11: 61,791,272 (GRCm39) Y396H probably damaging Het
Ap3b1 C G 13: 94,619,771 (GRCm39) S778W unknown Het
Arb2a T C 13: 78,050,837 (GRCm39) M165T probably benign Het
Baat G A 4: 49,502,925 (GRCm39) L66F probably benign Het
Cachd1 A G 4: 100,845,759 (GRCm39) N981S probably damaging Het
Cacna1c C T 6: 118,753,407 (GRCm39) R243H Het
Cdh23 T A 10: 60,150,390 (GRCm39) I2527F probably damaging Het
Cinp A G 12: 110,840,557 (GRCm39) V198A probably benign Het
Clec4d T C 6: 123,244,123 (GRCm39) probably null Het
Cnn3 A G 3: 121,248,704 (GRCm39) I204V probably benign Het
Cpxm2 C A 7: 131,650,800 (GRCm39) G620V probably damaging Het
Ctrl A C 8: 106,659,497 (GRCm39) S93A probably benign Het
Cyp2d34 A G 15: 82,501,425 (GRCm39) V301A possibly damaging Het
Dnaaf5 G T 5: 139,147,565 (GRCm39) K376N probably damaging Het
Eno2 C T 6: 124,740,137 (GRCm39) D300N probably damaging Het
Entrep3 T A 3: 89,093,083 (GRCm39) Y280* probably null Het
Fam117b T A 1: 60,014,046 (GRCm39) N440K probably damaging Het
Fam131a A G 16: 20,514,584 (GRCm39) S62G probably benign Het
Fancm T A 12: 65,163,240 (GRCm39) probably null Het
Fancm A G 12: 65,165,173 (GRCm39) D1506G probably benign Het
Fhad1 C A 4: 141,632,902 (GRCm39) V1201L probably benign Het
Gdpd4 T A 7: 97,623,185 (GRCm39) C265* probably null Het
Gm3127 A T 14: 15,425,888 (GRCm39) T98S probably null Het
Gpsm1 A T 2: 26,230,448 (GRCm39) D466V probably benign Het
Gramd1a T G 7: 30,842,992 (GRCm39) K76Q probably damaging Het
Gstp3 T C 19: 4,108,808 (GRCm39) D24G probably damaging Het
Kalrn G A 16: 33,810,161 (GRCm39) T2531I possibly damaging Het
Klk7 C A 7: 43,462,333 (GRCm39) D108E probably damaging Het
Klkb1 A G 8: 45,740,002 (GRCm39) S97P probably damaging Het
Krt13 T C 11: 100,012,008 (GRCm39) D105G probably damaging Het
Lingo2 T A 4: 35,709,302 (GRCm39) H226L probably benign Het
Lrba T C 3: 86,275,896 (GRCm39) S1755P probably damaging Het
Marf1 A G 16: 13,946,470 (GRCm39) V1217A probably damaging Het
Mtss1 A T 15: 58,842,858 (GRCm39) V118E possibly damaging Het
Mug1 T A 6: 121,850,593 (GRCm39) D696E probably benign Het
Ndufa3 C T 7: 3,623,003 (GRCm39) P56L probably damaging Het
Nop56 T A 2: 130,120,205 (GRCm39) C471S possibly damaging Het
Obscn T A 11: 58,891,652 (GRCm39) H6960L unknown Het
Or13a22 C T 7: 140,073,049 (GRCm39) T166I probably benign Het
Pcdhb10 A C 18: 37,546,619 (GRCm39) Q565P probably benign Het
Pde6g T A 11: 120,338,953 (GRCm39) H79L possibly damaging Het
Phrf1 G T 7: 140,836,524 (GRCm39) M265I unknown Het
Pkd2 T C 5: 104,630,986 (GRCm39) F470S probably damaging Het
Plekhm1 T A 11: 103,271,153 (GRCm39) D446V probably damaging Het
Prkaca A T 8: 84,721,963 (GRCm39) T325S probably benign Het
Proz A T 8: 13,111,027 (GRCm39) probably benign Het
Pten T C 19: 32,792,894 (GRCm39) F238L probably benign Het
Ptpn21 G A 12: 98,671,435 (GRCm39) L198F probably damaging Het
Rbm5 A T 9: 107,628,930 (GRCm39) S394T probably benign Het
Scaf8 T G 17: 3,227,994 (GRCm39) S408A unknown Het
Slc41a3 T A 6: 90,617,909 (GRCm39) F312I probably damaging Het
Soat2 T A 15: 102,059,598 (GRCm39) probably null Het
Spopfm1 G C 3: 94,173,154 (GRCm39) S50T probably benign Het
Stox1 G T 10: 62,500,723 (GRCm39) D612E probably benign Het
Suco T C 1: 161,665,365 (GRCm39) I530M possibly damaging Het
Syne2 A G 12: 76,030,501 (GRCm39) probably null Het
Thbd G A 2: 148,249,664 (GRCm39) A68V probably damaging Het
Tmem109 A T 19: 10,855,466 (GRCm39) M4K unknown Het
Tmub1 G C 5: 24,651,664 (GRCm39) P85R possibly damaging Het
Tnk2 A C 16: 32,500,053 (GRCm39) Q1039H probably damaging Het
Tpm3 T C 3: 89,993,775 (GRCm39) L89S probably damaging Het
Unc13b C T 4: 43,232,573 (GRCm39) R432* probably null Het
Vmn2r59 T A 7: 41,661,707 (GRCm39) I703F probably damaging Het
Xylt1 T A 7: 117,074,749 (GRCm39) I122N probably benign Het
Zc3h12c T C 9: 52,055,248 (GRCm39) E187G probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTACCCATCCGTCTGG -3'
(R):5'- GCCCATGTTGAAAAGCATTGTTTTG -3'

Sequencing Primer
(F):5'- ACCCATCCGTCTGGTTTGC -3'
(R):5'- GCTTACATTTTCTCAAAGACTTAGGG -3'
Posted On 2019-12-20