Incidental Mutation 'R0201:Csf2ra'
ID 60792
Institutional Source Beutler Lab
Gene Symbol Csf2ra
Ensembl Gene ENSMUSG00000059326
Gene Name colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms GM-CSF-Ra, GM-CSFRalpha, Csfgmra, CD116
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R0201 (G1)
Quality Score 133
Status Validated
Chromosome 19
Chromosomal Location 61212395-61216867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61214006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 305 (T305S)
Ref Sequence ENSEMBL: ENSMUSP00000075423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076046]
AlphaFold Q00941
Predicted Effect probably benign
Transcript: ENSMUST00000076046
AA Change: T305S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075423
Gene: ENSMUSG00000059326
AA Change: T305S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:IL6Ra-bind 129 223 5.2e-23 PFAM
FN3 226 311 9.19e-1 SMART
transmembrane domain 326 348 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,819,406 (GRCm39) probably null Het
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Cc2d2a A G 5: 43,894,854 (GRCm39) Y1437C probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Cdhr5 T A 7: 140,856,291 (GRCm39) D88V probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Poldip3 T A 15: 83,019,497 (GRCm39) M182L probably benign Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Psmd1 C T 1: 86,046,338 (GRCm39) T702M probably benign Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Csf2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Csf2ra APN 19 61,215,271 (GRCm39) missense possibly damaging 0.87
IGL01465:Csf2ra APN 19 61,214,436 (GRCm39) missense possibly damaging 0.95
IGL01693:Csf2ra APN 19 61,214,434 (GRCm39) missense possibly damaging 0.57
IGL02474:Csf2ra APN 19 61,214,975 (GRCm39) missense possibly damaging 0.95
IGL02950:Csf2ra APN 19 61,215,607 (GRCm39) missense probably benign 0.01
R0054:Csf2ra UTSW 19 61,215,035 (GRCm39) missense probably damaging 1.00
R0452:Csf2ra UTSW 19 61,215,333 (GRCm39) missense probably benign 0.02
R1735:Csf2ra UTSW 19 61,214,782 (GRCm39) missense probably damaging 0.99
R2016:Csf2ra UTSW 19 61,215,331 (GRCm39) missense probably benign 0.01
R2157:Csf2ra UTSW 19 61,215,509 (GRCm39) missense probably benign 0.05
R3149:Csf2ra UTSW 19 61,215,758 (GRCm39) missense possibly damaging 0.83
R3150:Csf2ra UTSW 19 61,215,758 (GRCm39) missense possibly damaging 0.83
R4747:Csf2ra UTSW 19 61,214,491 (GRCm39) nonsense probably null
R4825:Csf2ra UTSW 19 61,214,990 (GRCm39) missense probably benign 0.10
R5580:Csf2ra UTSW 19 61,214,655 (GRCm39) missense probably damaging 1.00
R5831:Csf2ra UTSW 19 61,213,650 (GRCm39) missense probably damaging 1.00
R5887:Csf2ra UTSW 19 61,215,766 (GRCm39) missense possibly damaging 0.92
R7105:Csf2ra UTSW 19 61,213,458 (GRCm39) missense possibly damaging 0.61
R7123:Csf2ra UTSW 19 61,215,300 (GRCm39) missense probably damaging 1.00
R7419:Csf2ra UTSW 19 61,215,491 (GRCm39) missense possibly damaging 0.94
R7721:Csf2ra UTSW 19 61,215,024 (GRCm39) missense probably damaging 1.00
R8918:Csf2ra UTSW 19 61,214,721 (GRCm39) missense probably damaging 1.00
R8972:Csf2ra UTSW 19 61,213,597 (GRCm39) missense probably null 0.09
R9320:Csf2ra UTSW 19 61,215,280 (GRCm39) missense possibly damaging 0.68
R9686:Csf2ra UTSW 19 61,213,629 (GRCm39) missense probably damaging 1.00
Z1177:Csf2ra UTSW 19 61,213,591 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACCTCAGGGTTCACTCGCAC -3'
(R):5'- TGAGCTGATGCAGGGGCATGAC -3'

Sequencing Primer
(F):5'- gggcagggcagAGTTCAC -3'
(R):5'- CAGGGGCATGACCTGGATG -3'
Posted On 2013-07-24