Incidental Mutation 'R7868:Ccdc33'
ID 607921
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7868 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58069091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 547 (I547F)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042205
AA Change: I338F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: I338F

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: I547F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: I547F

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
AA Change: I338F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: I338F

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215944
AA Change: I547F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 11: 43,587,430 probably null Het
Acacb A G 5: 114,248,227 E2274G probably benign Het
Adam7 A G 14: 68,532,641 I21T possibly damaging Het
Aldh3b3 C T 19: 3,968,492 R57* probably null Het
Arhgap22 T C 14: 33,364,516 probably benign Het
B4galt5 G T 2: 167,301,420 Y361* probably null Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bsn G T 9: 108,114,899 A1218D possibly damaging Het
Ccdc141 T C 2: 77,108,412 D283G probably damaging Het
Chdh A G 14: 30,031,331 N66D probably benign Het
Ckap2l T A 2: 129,285,289 Q323L probably damaging Het
Cpvl T A 6: 53,974,760 I13F possibly damaging Het
Creb3l2 G A 6: 37,335,869 P410L probably damaging Het
Dna2 T C 10: 62,969,864 V960A probably benign Het
Dopey1 G A 9: 86,501,984 probably null Het
Dpysl5 A T 5: 30,745,416 D64V probably damaging Het
Dysf A G 6: 84,114,099 Q1041R probably benign Het
Efcab7 T C 4: 99,888,957 V242A probably benign Het
Ehbp1 G A 11: 22,146,542 R341* probably null Het
Fbxo32 A T 15: 58,214,590 W8R probably damaging Het
Fpgs T C 2: 32,683,460 N455D probably damaging Het
Fsip1 G A 2: 118,136,486 Q453* probably null Het
Gm13103 A G 4: 143,851,584 H138R possibly damaging Het
Gm8257 T A 14: 44,657,297 E12V probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Kdm3a A T 6: 71,595,489 D1029E probably benign Het
Lipo4 T G 19: 33,511,568 Q205P possibly damaging Het
Lpar6 A T 14: 73,238,995 N132I probably damaging Het
Lrp1b C T 2: 41,449,234 G866S Het
Man2c1 T C 9: 57,137,986 F460L probably damaging Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Map4k1 A T 7: 28,999,962 probably null Het
Matn1 A G 4: 130,955,000 E496G probably damaging Het
Mfsd2a A T 4: 122,956,855 V76E possibly damaging Het
Mtpap A G 18: 4,380,673 E117G probably damaging Het
Muc3 T A 5: 137,146,777 N15I Het
Mut C T 17: 40,947,043 R367C probably damaging Het
Ndufa10 A G 1: 92,460,447 Y275H probably damaging Het
Nlrc4 A T 17: 74,448,052 H56Q possibly damaging Het
Nrde2 G A 12: 100,131,187 R785C possibly damaging Het
Nsun4 C A 4: 116,034,132 C350F probably benign Het
Olfr1410 G A 1: 92,608,515 G226D possibly damaging Het
Olfr229 T A 9: 39,909,986 F61Y probably benign Het
Olfr417 A G 1: 174,368,985 T23A probably benign Het
Olfr560 A G 7: 102,753,605 L108P possibly damaging Het
Pdcd7 T A 9: 65,346,979 C280S probably damaging Het
Peak1 G T 9: 56,260,470 T58K probably damaging Het
Phactr2 T C 10: 13,232,609 E573G probably damaging Het
Ptprz1 G A 6: 23,000,964 A1018T not run Het
Ralgapa1 G T 12: 55,612,638 D2032E probably benign Het
Rapgef4 T A 2: 72,201,137 N488K probably benign Het
Slc1a2 A G 2: 102,761,185 D420G probably benign Het
Smyd5 T A 6: 85,444,315 L337Q probably damaging Het
Tenm4 G A 7: 96,906,380 R2764H possibly damaging Het
Tex35 A T 1: 157,099,338 Y195* probably null Het
Tln2 T C 9: 67,348,226 K690E probably damaging Het
Trpc4 A G 3: 54,302,286 T691A probably benign Het
Tsr1 T A 11: 74,900,332 F246I possibly damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Ubr4 A T 4: 139,460,033 Y669F unknown Het
Uox A C 3: 146,610,274 D12A probably benign Het
Wdr17 A G 8: 54,696,267 probably null Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9204:Ccdc33 UTSW 9 58031105 missense probably benign 0.33
R9280:Ccdc33 UTSW 9 58058266 missense probably benign
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58117625 missense possibly damaging 0.96
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCTGATAGAGGCTGCTAAGAAG -3'
(R):5'- TCACTGACAGGACCTGATTTGG -3'

Sequencing Primer
(F):5'- AGCTACATTTACCCGGATGG -3'
(R):5'- GACAGGACCTGATTTGGCCTTTC -3'
Posted On 2019-12-20