Incidental Mutation 'R7868:Fbxo32'
ID607940
Institutional Source Beutler Lab
Gene Symbol Fbxo32
Ensembl Gene ENSMUSG00000022358
Gene NameF-box protein 32
Synonyms4833442G10Rik, atrogin-1, MAFbx, ATROGIN1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7868 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location58175879-58214932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58214590 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 8 (W8R)
Ref Sequence ENSEMBL: ENSMUSP00000022986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022986]
Predicted Effect probably damaging
Transcript: ENSMUST00000022986
AA Change: W8R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022986
Gene: ENSMUSG00000022358
AA Change: W8R

DomainStartEndE-ValueType
Blast:FBOX 228 269 6e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 11: 43,587,430 probably null Het
Acacb A G 5: 114,248,227 E2274G probably benign Het
Adam7 A G 14: 68,532,641 I21T possibly damaging Het
Aldh3b3 C T 19: 3,968,492 R57* probably null Het
Arhgap22 T C 14: 33,364,516 probably benign Het
B4galt5 G T 2: 167,301,420 Y361* probably null Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bsn G T 9: 108,114,899 A1218D possibly damaging Het
Ccdc141 T C 2: 77,108,412 D283G probably damaging Het
Ccdc33 T A 9: 58,069,091 I547F probably benign Het
Chdh A G 14: 30,031,331 N66D probably benign Het
Ckap2l T A 2: 129,285,289 Q323L probably damaging Het
Cpvl T A 6: 53,974,760 I13F possibly damaging Het
Creb3l2 G A 6: 37,335,869 P410L probably damaging Het
Dna2 T C 10: 62,969,864 V960A probably benign Het
Dopey1 G A 9: 86,501,984 probably null Het
Dpysl5 A T 5: 30,745,416 D64V probably damaging Het
Dysf A G 6: 84,114,099 Q1041R probably benign Het
Efcab7 T C 4: 99,888,957 V242A probably benign Het
Ehbp1 G A 11: 22,146,542 R341* probably null Het
Fpgs T C 2: 32,683,460 N455D probably damaging Het
Fsip1 G A 2: 118,136,486 Q453* probably null Het
Gm13103 A G 4: 143,851,584 H138R possibly damaging Het
Gm8257 T A 14: 44,657,297 E12V probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Kdm3a A T 6: 71,595,489 D1029E probably benign Het
Lipo4 T G 19: 33,511,568 Q205P possibly damaging Het
Lpar6 A T 14: 73,238,995 N132I probably damaging Het
Lrp1b C T 2: 41,449,234 G866S Het
Man2c1 T C 9: 57,137,986 F460L probably damaging Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Map4k1 A T 7: 28,999,962 probably null Het
Matn1 A G 4: 130,955,000 E496G probably damaging Het
Mfsd2a A T 4: 122,956,855 V76E possibly damaging Het
Mtpap A G 18: 4,380,673 E117G probably damaging Het
Muc3 T A 5: 137,146,777 N15I Het
Mut C T 17: 40,947,043 R367C probably damaging Het
Ndufa10 A G 1: 92,460,447 Y275H probably damaging Het
Nlrc4 A T 17: 74,448,052 H56Q possibly damaging Het
Nrde2 G A 12: 100,131,187 R785C possibly damaging Het
Nsun4 C A 4: 116,034,132 C350F probably benign Het
Olfr1410 G A 1: 92,608,515 G226D possibly damaging Het
Olfr229 T A 9: 39,909,986 F61Y probably benign Het
Olfr417 A G 1: 174,368,985 T23A probably benign Het
Olfr560 A G 7: 102,753,605 L108P possibly damaging Het
Pdcd7 T A 9: 65,346,979 C280S probably damaging Het
Peak1 G T 9: 56,260,470 T58K probably damaging Het
Phactr2 T C 10: 13,232,609 E573G probably damaging Het
Ptprz1 G A 6: 23,000,964 A1018T not run Het
Ralgapa1 G T 12: 55,612,638 D2032E probably benign Het
Rapgef4 T A 2: 72,201,137 N488K probably benign Het
Slc1a2 A G 2: 102,761,185 D420G probably benign Het
Smyd5 T A 6: 85,444,315 L337Q probably damaging Het
Tenm4 G A 7: 96,906,380 R2764H possibly damaging Het
Tex35 A T 1: 157,099,338 Y195* probably null Het
Tln2 T C 9: 67,348,226 K690E probably damaging Het
Trpc4 A G 3: 54,302,286 T691A probably benign Het
Tsr1 T A 11: 74,900,332 F246I possibly damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Ubr4 A T 4: 139,460,033 Y669F unknown Het
Uox A C 3: 146,610,274 D12A probably benign Het
Wdr17 A G 8: 54,696,267 probably null Het
Other mutations in Fbxo32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Fbxo32 APN 15 58184236 missense probably damaging 0.98
IGL02371:Fbxo32 APN 15 58181464 utr 3 prime probably benign
IGL02721:Fbxo32 APN 15 58182962 missense possibly damaging 0.85
R0277:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R0323:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R1661:Fbxo32 UTSW 15 58191469 missense probably damaging 1.00
R2315:Fbxo32 UTSW 15 58208035 missense probably benign 0.28
R2321:Fbxo32 UTSW 15 58191293 missense possibly damaging 0.52
R2849:Fbxo32 UTSW 15 58207972 missense probably benign
R4233:Fbxo32 UTSW 15 58192333 missense possibly damaging 0.81
R4569:Fbxo32 UTSW 15 58181477 missense probably damaging 0.99
R6856:Fbxo32 UTSW 15 58214641 start gained probably benign
R7747:Fbxo32 UTSW 15 58191361 missense probably damaging 1.00
R8317:Fbxo32 UTSW 15 58205230 missense probably damaging 1.00
Z1176:Fbxo32 UTSW 15 58205242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCGACCTTTACCGAAATC -3'
(R):5'- AGCCCTCCACACTAGTTGAC -3'

Sequencing Primer
(F):5'- ATTCTGGCCCAGACCTGC -3'
(R):5'- ACACTAGTTGACCCACTCTTG -3'
Posted On2019-12-20