Incidental Mutation 'R7868:Lipo4'
ID 607946
Institutional Source Beutler Lab
Gene Symbol Lipo4
Ensembl Gene ENSMUSG00000079344
Gene Name lipase, member O4
Synonyms Gm6857
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7868 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 33498037-33517780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 33511568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 205 (Q205P)
Ref Sequence ENSEMBL: ENSMUSP00000108130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112511]
AlphaFold F6RR30
Predicted Effect possibly damaging
Transcript: ENSMUST00000112511
AA Change: Q205P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108130
Gene: ENSMUSG00000079344
AA Change: Q205P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Abhydro_lipase 35 97 3e-24 PFAM
Pfam:Hydrolase_4 74 239 4.7e-8 PFAM
Pfam:Abhydrolase_1 78 214 2.5e-16 PFAM
Pfam:Abhydrolase_5 78 372 1.1e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121321
Gene: ENSMUSG00000079344
AA Change: Q206P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 1.3e-24 PFAM
Pfam:Hydrolase_4 76 241 7.1e-9 PFAM
Pfam:Abhydrolase_1 80 214 8.8e-17 PFAM
Pfam:Abhydrolase_5 80 235 1.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 11: 43,587,430 probably null Het
Acacb A G 5: 114,248,227 E2274G probably benign Het
Adam7 A G 14: 68,532,641 I21T possibly damaging Het
Aldh3b3 C T 19: 3,968,492 R57* probably null Het
Arhgap22 T C 14: 33,364,516 probably benign Het
B4galt5 G T 2: 167,301,420 Y361* probably null Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bsn G T 9: 108,114,899 A1218D possibly damaging Het
Ccdc141 T C 2: 77,108,412 D283G probably damaging Het
Ccdc33 T A 9: 58,069,091 I547F probably benign Het
Chdh A G 14: 30,031,331 N66D probably benign Het
Ckap2l T A 2: 129,285,289 Q323L probably damaging Het
Cpvl T A 6: 53,974,760 I13F possibly damaging Het
Creb3l2 G A 6: 37,335,869 P410L probably damaging Het
Dna2 T C 10: 62,969,864 V960A probably benign Het
Dopey1 G A 9: 86,501,984 probably null Het
Dpysl5 A T 5: 30,745,416 D64V probably damaging Het
Dysf A G 6: 84,114,099 Q1041R probably benign Het
Efcab7 T C 4: 99,888,957 V242A probably benign Het
Ehbp1 G A 11: 22,146,542 R341* probably null Het
Fbxo32 A T 15: 58,214,590 W8R probably damaging Het
Fpgs T C 2: 32,683,460 N455D probably damaging Het
Fsip1 G A 2: 118,136,486 Q453* probably null Het
Gm13103 A G 4: 143,851,584 H138R possibly damaging Het
Gm8257 T A 14: 44,657,297 E12V probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Kdm3a A T 6: 71,595,489 D1029E probably benign Het
Lpar6 A T 14: 73,238,995 N132I probably damaging Het
Lrp1b C T 2: 41,449,234 G866S Het
Man2c1 T C 9: 57,137,986 F460L probably damaging Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Map4k1 A T 7: 28,999,962 probably null Het
Matn1 A G 4: 130,955,000 E496G probably damaging Het
Mfsd2a A T 4: 122,956,855 V76E possibly damaging Het
Mtpap A G 18: 4,380,673 E117G probably damaging Het
Muc3 T A 5: 137,146,777 N15I Het
Mut C T 17: 40,947,043 R367C probably damaging Het
Ndufa10 A G 1: 92,460,447 Y275H probably damaging Het
Nlrc4 A T 17: 74,448,052 H56Q possibly damaging Het
Nrde2 G A 12: 100,131,187 R785C possibly damaging Het
Nsun4 C A 4: 116,034,132 C350F probably benign Het
Olfr1410 G A 1: 92,608,515 G226D possibly damaging Het
Olfr229 T A 9: 39,909,986 F61Y probably benign Het
Olfr417 A G 1: 174,368,985 T23A probably benign Het
Olfr560 A G 7: 102,753,605 L108P possibly damaging Het
Pdcd7 T A 9: 65,346,979 C280S probably damaging Het
Peak1 G T 9: 56,260,470 T58K probably damaging Het
Phactr2 T C 10: 13,232,609 E573G probably damaging Het
Ptprz1 G A 6: 23,000,964 A1018T not run Het
Ralgapa1 G T 12: 55,612,638 D2032E probably benign Het
Rapgef4 T A 2: 72,201,137 N488K probably benign Het
Slc1a2 A G 2: 102,761,185 D420G probably benign Het
Smyd5 T A 6: 85,444,315 L337Q probably damaging Het
Tenm4 G A 7: 96,906,380 R2764H possibly damaging Het
Tex35 A T 1: 157,099,338 Y195* probably null Het
Tln2 T C 9: 67,348,226 K690E probably damaging Het
Trpc4 A G 3: 54,302,286 T691A probably benign Het
Tsr1 T A 11: 74,900,332 F246I possibly damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Ubr4 A T 4: 139,460,033 Y669F unknown Het
Uox A C 3: 146,610,274 D12A probably benign Het
Wdr17 A G 8: 54,696,267 probably null Het
Other mutations in Lipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Lipo4 APN 19 33515686 missense probably damaging 1.00
IGL01609:Lipo4 APN 19 33499254 missense probably benign 0.01
IGL01731:Lipo4 APN 19 33512613 missense probably damaging 1.00
R0134:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R0225:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R1155:Lipo4 UTSW 19 33503195 missense probably benign
R1381:Lipo4 UTSW 19 33499341 missense probably benign 0.02
R1460:Lipo4 UTSW 19 33499318 missense probably benign
R1607:Lipo4 UTSW 19 33512673 missense probably damaging 1.00
R1777:Lipo4 UTSW 19 33499321 missense probably damaging 1.00
R1919:Lipo4 UTSW 19 33499271 missense possibly damaging 0.66
R1998:Lipo4 UTSW 19 33514301 missense probably damaging 0.98
R2088:Lipo4 UTSW 19 33500069 missense possibly damaging 0.95
R2112:Lipo4 UTSW 19 33511526 missense probably benign 0.07
R3931:Lipo4 UTSW 19 33503219 missense probably benign
R4588:Lipo4 UTSW 19 33499247 missense possibly damaging 0.82
R4869:Lipo4 UTSW 19 33501553 critical splice donor site probably null
R5406:Lipo4 UTSW 19 33503218 missense probably benign 0.00
R5640:Lipo4 UTSW 19 33501586 missense possibly damaging 0.92
R6160:Lipo4 UTSW 19 33503293 missense probably damaging 0.99
R6957:Lipo4 UTSW 19 33499367 missense probably benign 0.30
R7403:Lipo4 UTSW 19 33503279 missense possibly damaging 0.91
R7816:Lipo4 UTSW 19 33514242 missense probably damaging 1.00
R7847:Lipo4 UTSW 19 33514199 missense possibly damaging 0.95
R7890:Lipo4 UTSW 19 33501564 missense probably damaging 1.00
R7975:Lipo4 UTSW 19 33512628 missense probably damaging 1.00
R8391:Lipo4 UTSW 19 33511565 missense probably benign 0.02
R9428:Lipo4 UTSW 19 33517674 missense probably benign 0.09
X0028:Lipo4 UTSW 19 33503288 frame shift probably null
Z1176:Lipo4 UTSW 19 33503184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGCCCAACTTTGAAATATGAC -3'
(R):5'- CACTCCGATGACTAAACTAAGGG -3'

Sequencing Primer
(F):5'- GCCCAACTTTGAAATATGACTCATTG -3'
(R):5'- CCGATGACTAAACTAAGGGAATATTC -3'
Posted On 2019-12-20