Incidental Mutation 'R7869:Olfr1208'
ID607953
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Nameolfactory receptor 1208
SynonymsMOR225-4, GA_x6K02T2Q125-50372411-50371485
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7869 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88895575-88902311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88897064 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 178 (I178V)
Ref Sequence ENSEMBL: ENSMUSP00000149280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
Predicted Effect probably benign
Transcript: ENSMUST00000099810
AA Change: I178V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: I178V

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214121
AA Change: I178V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214297
AA Change: I178V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Alkbh8 A T 9: 3,359,503 H264L probably damaging Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nmd3 T C 3: 69,726,417 L79P probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13c T G 9: 73,694,877 L1362F probably damaging Het
Vmn2r11 A G 5: 109,052,120 V489A probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGAAAGAGCTTTGCGGCG -3'
(R):5'- TCTTTGGTGCCACTGAGATATTC -3'

Sequencing Primer
(F):5'- GGCTCTCTGATGACCTGGTC -3'
(R):5'- TGCCACTGAGATATTCATCTTGG -3'
Posted On2019-12-20