Incidental Mutation 'R7869:Nmd3'
ID607956
Institutional Source Beutler Lab
Gene Symbol Nmd3
Ensembl Gene ENSMUSG00000027787
Gene NameNMD3 ribosome export adaptor
SynonymsC87860
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7869 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location69721985-69756373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69726417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 79 (L79P)
Ref Sequence ENSEMBL: ENSMUSP00000029358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029358] [ENSMUST00000135266] [ENSMUST00000143041] [ENSMUST00000143249]
Predicted Effect probably damaging
Transcript: ENSMUST00000029358
AA Change: L79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787
AA Change: L79P

DomainStartEndE-ValueType
Pfam:NMD3 17 246 6.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135266
AA Change: L79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142290
Gene: ENSMUSG00000027787
AA Change: L79P

DomainStartEndE-ValueType
Pfam:NMD3 17 128 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143041
Predicted Effect probably benign
Transcript: ENSMUST00000143249
SMART Domains Protein: ENSMUSP00000115736
Gene: ENSMUSG00000027787

DomainStartEndE-ValueType
Pfam:NMD3 17 76 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Alkbh8 A T 9: 3,359,503 H264L probably damaging Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr1208 T C 2: 88,897,064 I178V probably benign Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13c T G 9: 73,694,877 L1362F probably damaging Het
Vmn2r11 A G 5: 109,052,120 V489A probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Nmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Nmd3 APN 3 69745240 missense possibly damaging 0.63
IGL01014:Nmd3 APN 3 69726386 missense probably benign 0.00
IGL01289:Nmd3 APN 3 69724287 missense possibly damaging 0.85
IGL02566:Nmd3 APN 3 69739914 unclassified probably benign
IGL03259:Nmd3 APN 3 69745243 missense possibly damaging 0.49
IGL03299:Nmd3 APN 3 69730429 splice site probably null
IGL03382:Nmd3 APN 3 69735088 missense probably damaging 0.99
R0017:Nmd3 UTSW 3 69736092 splice site probably null
R0025:Nmd3 UTSW 3 69748321 missense probably damaging 1.00
R0350:Nmd3 UTSW 3 69743574 missense probably damaging 1.00
R1136:Nmd3 UTSW 3 69746716 splice site probably benign
R1635:Nmd3 UTSW 3 69739984 missense probably benign 0.03
R3081:Nmd3 UTSW 3 69724399 splice site probably benign
R3686:Nmd3 UTSW 3 69746762 missense probably damaging 1.00
R3758:Nmd3 UTSW 3 69724308 nonsense probably null
R4384:Nmd3 UTSW 3 69724398 splice site probably benign
R4774:Nmd3 UTSW 3 69745236 missense probably benign 0.11
R4778:Nmd3 UTSW 3 69731591 nonsense probably null
R4953:Nmd3 UTSW 3 69731637 missense possibly damaging 0.92
R5000:Nmd3 UTSW 3 69717402 unclassified probably benign
R5182:Nmd3 UTSW 3 69722468 critical splice donor site probably null
R6043:Nmd3 UTSW 3 69745247 missense probably benign
R6355:Nmd3 UTSW 3 69729347 missense probably benign 0.22
R6760:Nmd3 UTSW 3 69746837 critical splice donor site probably null
R8024:Nmd3 UTSW 3 69729965 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGTCTCATGGGGTAAAGC -3'
(R):5'- TTATGGCAAAGACACTTGGTTC -3'

Sequencing Primer
(F):5'- CTCATGGGGTAAAGCTTTAGAGTAG -3'
(R):5'- GGCAAAGACACTTGGTTCAATTTCC -3'
Posted On2019-12-20