Incidental Mutation 'R7869:Vmn2r11'
ID607965
Institutional Source Beutler Lab
Gene Symbol Vmn2r11
Ensembl Gene ENSMUSG00000091450
Gene Namevomeronasal 2, receptor 11
SynonymsEG384219
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7869 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109046873-109059452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109052120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 489 (V489A)
Ref Sequence ENSEMBL: ENSMUSP00000133218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164875]
Predicted Effect probably damaging
Transcript: ENSMUST00000164875
AA Change: V489A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: V489A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 167 475 1.6e-29 PFAM
Pfam:NCD3G 520 574 9.1e-19 PFAM
Pfam:7tm_3 607 842 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Alkbh8 A T 9: 3,359,503 H264L probably damaging Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nmd3 T C 3: 69,726,417 L79P probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr1208 T C 2: 88,897,064 I178V probably benign Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13c T G 9: 73,694,877 L1362F probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Vmn2r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn2r11 APN 5 109047019 missense probably benign 0.00
IGL01677:Vmn2r11 APN 5 109053957 missense possibly damaging 0.50
IGL02048:Vmn2r11 APN 5 109054792 missense probably benign 0.00
IGL02559:Vmn2r11 APN 5 109052180 missense probably damaging 0.98
IGL02879:Vmn2r11 APN 5 109053838 missense possibly damaging 0.95
IGL03084:Vmn2r11 APN 5 109059343 missense probably benign 0.00
IGL03163:Vmn2r11 APN 5 109053826 missense probably benign 0.41
IGL03289:Vmn2r11 APN 5 109048922 splice site probably benign
IGL03294:Vmn2r11 APN 5 109054069 missense probably benign 0.22
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0421:Vmn2r11 UTSW 5 109059428 missense probably benign 0.00
R0549:Vmn2r11 UTSW 5 109052097 missense possibly damaging 0.80
R0628:Vmn2r11 UTSW 5 109047731 missense possibly damaging 0.88
R1523:Vmn2r11 UTSW 5 109053841 missense probably benign 0.25
R1660:Vmn2r11 UTSW 5 109053858 missense possibly damaging 0.79
R1827:Vmn2r11 UTSW 5 109052072 missense probably benign 0.01
R1913:Vmn2r11 UTSW 5 109054788 missense probably benign
R2260:Vmn2r11 UTSW 5 109053791 nonsense probably null
R2400:Vmn2r11 UTSW 5 109052062 missense probably benign 0.03
R3933:Vmn2r11 UTSW 5 109053394 missense probably damaging 0.97
R4091:Vmn2r11 UTSW 5 109054750 critical splice donor site probably null
R4624:Vmn2r11 UTSW 5 109052235 missense probably damaging 0.99
R4762:Vmn2r11 UTSW 5 109047570 missense probably damaging 1.00
R5256:Vmn2r11 UTSW 5 109054792 missense probably benign 0.26
R5370:Vmn2r11 UTSW 5 109047555 missense probably damaging 1.00
R5419:Vmn2r11 UTSW 5 109059358 missense possibly damaging 0.55
R5516:Vmn2r11 UTSW 5 109047166 missense probably damaging 0.98
R5643:Vmn2r11 UTSW 5 109047003 missense probably damaging 1.00
R5671:Vmn2r11 UTSW 5 109054906 missense probably benign 0.03
R5679:Vmn2r11 UTSW 5 109054842 missense probably benign 0.00
R5739:Vmn2r11 UTSW 5 109059248 critical splice donor site probably null
R5746:Vmn2r11 UTSW 5 109053694 missense probably benign 0.41
R5995:Vmn2r11 UTSW 5 109047055 missense probably damaging 1.00
R6147:Vmn2r11 UTSW 5 109054834 missense probably benign 0.04
R6220:Vmn2r11 UTSW 5 109053568 missense probably benign 0.09
R6374:Vmn2r11 UTSW 5 109053813 missense possibly damaging 0.65
R6491:Vmn2r11 UTSW 5 109048934 missense possibly damaging 0.95
R6804:Vmn2r11 UTSW 5 109053484 missense probably damaging 1.00
R6814:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R6872:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R7014:Vmn2r11 UTSW 5 109053423 missense probably damaging 1.00
R7041:Vmn2r11 UTSW 5 109054950 missense probably damaging 1.00
R7043:Vmn2r11 UTSW 5 109052232 missense probably benign 0.00
R7050:Vmn2r11 UTSW 5 109054791 missense probably benign 0.05
R7184:Vmn2r11 UTSW 5 109053415 missense probably damaging 1.00
R7388:Vmn2r11 UTSW 5 109054876 missense probably benign 0.05
R7477:Vmn2r11 UTSW 5 109059348 missense possibly damaging 0.67
R7524:Vmn2r11 UTSW 5 109053982 missense probably benign 0.01
R7682:Vmn2r11 UTSW 5 109047615 missense probably benign 0.02
R7715:Vmn2r11 UTSW 5 109047441 missense probably damaging 0.99
R7952:Vmn2r11 UTSW 5 109052120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGCTATTGAACTTTGAATCC -3'
(R):5'- TGCATGTGTAAACGTCTAATGATGC -3'

Sequencing Primer
(F):5'- GAATCCAGAGGTCTTTGGTCCC -3'
(R):5'- CGTCTAATGATGCATCTCACTTAGG -3'
Posted On2019-12-20