Incidental Mutation 'R7869:Unc13c'
ID607982
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7869 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73694877 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1362 (L1362F)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: L1362F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: L1362F

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: L1362F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: L1362F

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Alkbh8 A T 9: 3,359,503 H264L probably damaging Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nmd3 T C 3: 69,726,417 L79P probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr1208 T C 2: 88,897,064 I178V probably benign Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vmn2r11 A G 5: 109,052,120 V489A probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAAGGGCCAGTTTTCCAC -3'
(R):5'- CTTGGCCCAATCTTTATGGTTG -3'

Sequencing Primer
(F):5'- CCTCAGCATACCACCTGTG -3'
(R):5'- CCCAATCTTTATGGTTGTGGTGAG -3'
Posted On2019-12-20