Incidental Mutation 'R0144:Dlec1'
ID60799
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0144 (G1)
Quality Score143
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119142866 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1345 (G1345V)
Ref Sequence ENSEMBL: ENSMUSP00000122380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect probably benign
Transcript: ENSMUST00000140326
AA Change: G1345V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: G1345V

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165231
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 intron probably null
Predicted Primers PCR Primer
(F):5'- AGTGAGATTGTGTGCCCTGAGACC -3'
(R):5'- CTCCTTATCCAAGCTCATGAAGCCC -3'

Sequencing Primer
(F):5'- CTCGGAGGCCAGCTTAC -3'
(R):5'- AACACAGTAGCCTCGTGTTC -3'
Posted On2013-07-24