Incidental Mutation 'R7870:Gm29106'
ID608026
Institutional Source Beutler Lab
Gene Symbol Gm29106
Ensembl Gene ENSMUSG00000102030
Gene Namepredicted gene 29106
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location118176542-118202307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118199155 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 192 (N192K)
Ref Sequence ENSEMBL: ENSMUSP00000141137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186264]
Predicted Effect possibly damaging
Transcript: ENSMUST00000186264
AA Change: N192K

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141137
Gene: ENSMUSG00000102030
AA Change: N192K

DomainStartEndE-ValueType
KRAB 8 66 2.8e-24 SMART
ZnF_C2H2 77 97 2.3e-2 SMART
ZnF_C2H2 105 127 4.5e-6 SMART
ZnF_C2H2 133 155 3.4e-6 SMART
ZnF_C2H2 161 183 3.2e-7 SMART
ZnF_C2H2 189 211 2.1e-4 SMART
ZnF_C2H2 217 239 6.3e-7 SMART
ZnF_C2H2 245 267 3.4e-6 SMART
ZnF_C2H2 273 295 3.2e-7 SMART
ZnF_C2H2 301 323 2.1e-4 SMART
ZnF_C2H2 329 351 6.3e-7 SMART
ZnF_C2H2 357 379 2.1e-4 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 1.1e-7 SMART
ZnF_C2H2 441 463 4e-5 SMART
ZnF_C2H2 469 491 1.3e-6 SMART
ZnF_C2H2 497 519 2.4e-6 SMART
ZnF_C2H2 525 547 2.3e-4 SMART
ZnF_C2H2 553 575 1.4e-4 SMART
ZnF_C2H2 581 603 1.9e-6 SMART
ZnF_C2H2 609 631 5.2e-5 SMART
ZnF_C2H2 637 659 1.7e-5 SMART
ZnF_C2H2 665 687 9.4e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Gm29106
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4985:Gm29106 UTSW 1 118199220 missense probably benign 0.02
R4991:Gm29106 UTSW 1 118178391 missense probably benign 0.01
R6029:Gm29106 UTSW 1 118200260 missense probably damaging 1.00
R6922:Gm29106 UTSW 1 118199794 missense probably damaging 0.98
R6954:Gm29106 UTSW 1 118200587 missense probably damaging 1.00
R6961:Gm29106 UTSW 1 118200398 nonsense probably null
R7232:Gm29106 UTSW 1 118199561 missense probably damaging 1.00
R7337:Gm29106 UTSW 1 118176912 missense unknown
R7457:Gm29106 UTSW 1 118199252 missense probably damaging 1.00
R7662:Gm29106 UTSW 1 118199407 missense possibly damaging 0.89
R7894:Gm29106 UTSW 1 118199535 missense probably damaging 1.00
R7953:Gm29106 UTSW 1 118199155 missense possibly damaging 0.55
R7977:Gm29106 UTSW 1 118199535 missense probably damaging 1.00
R8099:Gm29106 UTSW 1 118198791 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAAGCTCAAGATACTCTTTCTG -3'
(R):5'- GAGGACTTGGTAAAAGATTTGCC -3'

Sequencing Primer
(F):5'- TCACCAGAGATTGCATACTGG -3'
(R):5'- TGCCACATTCATTACATTTGTAAGG -3'
Posted On2019-12-20