Incidental Mutation 'R7870:H3f3a'
ID608027
Institutional Source Beutler Lab
Gene Symbol H3f3a
Ensembl Gene ENSMUSG00000060743
Gene NameH3 histone, family 3A
SynonymsH3.3A
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location180800832-180813943 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 180811925 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000124509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081026] [ENSMUST00000159685] [ENSMUST00000159789] [ENSMUST00000161308] [ENSMUST00000162118] [ENSMUST00000162814]
Predicted Effect probably null
Transcript: ENSMUST00000081026
AA Change: M1K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079816
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
H3 34 135 2.77e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159685
AA Change: M1K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124040
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
PDB:4HGA|B 1 52 7e-30 PDB
Blast:H3 8 52 9e-23 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159789
AA Change: M1K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125754
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
H3 34 119 8.9e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161308
AA Change: M1K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124509
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162118
AA Change: M1K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123946
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
PDB:4HGA|B 1 55 3e-32 PDB
Blast:H3 8 52 1e-22 BLAST
SCOP:d1hq3c_ 42 55 9e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162814
AA Change: M1K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125104
Gene: ENSMUSG00000060743
AA Change: M1K

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutants for a hypomorphic gene trap allele display partial neonatal lethality, reduced fertility, growth abnormalities and neuromuscular defects. Mice homozygous for a reporter allele exhibit reduced body size and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in H3f3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2297:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2298:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2299:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2300:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2351:H3f3a UTSW 1 180810158 missense probably benign
R2895:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4052:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4208:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4455:H3f3a UTSW 1 180803103 missense probably benign 0.00
R5582:H3f3a UTSW 1 180810085 intron probably benign
R7953:H3f3a UTSW 1 180811925 start codon destroyed probably null 0.61
Predicted Primers PCR Primer
(F):5'- GAGAAACATCTTTTCCCCATAGC -3'
(R):5'- GATAGATGTAATCCGCGCCCTTC -3'

Sequencing Primer
(F):5'- CCTGTTAAATTACACGGACATACTGC -3'
(R):5'- GTTCTGGCAGGAATACTGT -3'
Posted On2019-12-20