Incidental Mutation 'R7870:Alb'
ID608037
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90472629 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 533 (F533L)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031314
AA Change: F533L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: F533L

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4473:Alb UTSW 5 90464053 missense probably damaging 1.00
R4670:Alb UTSW 5 90462806 missense probably benign 0.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7268:Alb UTSW 5 90462716 missense probably benign 0.15
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
R7575:Alb UTSW 5 90465929 missense probably damaging 1.00
R7651:Alb UTSW 5 90467355 missense probably damaging 1.00
R7652:Alb UTSW 5 90467355 missense probably damaging 1.00
R7654:Alb UTSW 5 90467355 missense probably damaging 1.00
R7669:Alb UTSW 5 90463991 missense possibly damaging 0.93
R7879:Alb UTSW 5 90472648 missense probably benign 0.21
R7953:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7962:Alb UTSW 5 90472648 missense probably benign 0.21
R8077:Alb UTSW 5 90467355 missense probably damaging 1.00
R8078:Alb UTSW 5 90467355 missense probably damaging 1.00
R8316:Alb UTSW 5 90468590 missense probably benign 0.20
Z1177:Alb UTSW 5 90468512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGGATTTCTAATGGCTAAC -3'
(R):5'- CTTTCAACTCAGTGATGCCAAC -3'

Sequencing Primer
(F):5'- TCTAATGGCTAACTCCATATGACAG -3'
(R):5'- CAACATCTAAACACTTCTCTCTAAGG -3'
Posted On2019-12-20