Incidental Mutation 'R7870:Sez6l'
ID608038
Institutional Source Beutler Lab
Gene Symbol Sez6l
Ensembl Gene ENSMUSG00000058153
Gene Nameseizure related 6 homolog like
SynonymsAcig1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location112419151-112577185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112438581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 683 (D683A)
Ref Sequence ENSEMBL: ENSMUSP00000078454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
Predicted Effect probably damaging
Transcript: ENSMUST00000075387
AA Change: D683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: D683A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079491
AA Change: D683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: D683A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197425
AA Change: D683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: D683A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000212480
AA Change: D683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212758
AA Change: D683A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Sez6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sez6l APN 5 112424645 missense probably damaging 1.00
IGL00494:Sez6l APN 5 112463003 missense probably damaging 1.00
IGL00693:Sez6l APN 5 112422013 missense probably damaging 1.00
IGL01146:Sez6l APN 5 112428409 missense probably damaging 1.00
IGL01382:Sez6l APN 5 112425621 missense probably benign 0.00
IGL01393:Sez6l APN 5 112438395 splice site probably benign
IGL01961:Sez6l APN 5 112471731 missense probably damaging 1.00
IGL02101:Sez6l APN 5 112472746 missense probably damaging 1.00
IGL02104:Sez6l APN 5 112426764 intron probably benign
IGL02316:Sez6l APN 5 112462962 missense probably damaging 1.00
IGL02965:Sez6l APN 5 112475574 missense probably damaging 0.99
IGL03102:Sez6l APN 5 112475403 missense probably benign 0.02
IGL03112:Sez6l APN 5 112473467 missense probably damaging 1.00
IGL03180:Sez6l APN 5 112436285 missense probably damaging 1.00
R0245:Sez6l UTSW 5 112475566 missense probably benign
R0662:Sez6l UTSW 5 112473422 missense probably damaging 1.00
R1227:Sez6l UTSW 5 112473464 missense probably damaging 1.00
R1605:Sez6l UTSW 5 112475049 missense probably damaging 1.00
R1873:Sez6l UTSW 5 112473410 splice site probably benign
R1878:Sez6l UTSW 5 112475223 missense probably damaging 0.98
R1892:Sez6l UTSW 5 112472799 missense probably damaging 1.00
R1961:Sez6l UTSW 5 112424615 splice site probably benign
R2038:Sez6l UTSW 5 112472752 missense possibly damaging 0.81
R2212:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R2315:Sez6l UTSW 5 112464597 missense probably benign 0.02
R2343:Sez6l UTSW 5 112464731 missense probably damaging 1.00
R3412:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3413:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3423:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R3425:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R4081:Sez6l UTSW 5 112461166 missense probably benign 0.01
R4574:Sez6l UTSW 5 112428478 missense probably damaging 1.00
R5792:Sez6l UTSW 5 112422024 nonsense probably null
R5864:Sez6l UTSW 5 112438400 critical splice donor site probably null
R6236:Sez6l UTSW 5 112475244 missense possibly damaging 0.86
R6274:Sez6l UTSW 5 112475365 nonsense probably null
R6466:Sez6l UTSW 5 112461141 splice site probably null
R6574:Sez6l UTSW 5 112576826 missense possibly damaging 0.89
R7008:Sez6l UTSW 5 112464695 missense probably damaging 1.00
R7241:Sez6l UTSW 5 112473480 missense probably benign
R7329:Sez6l UTSW 5 112440907 missense probably damaging 0.99
R7335:Sez6l UTSW 5 112576812 synonymous probably null
R7502:Sez6l UTSW 5 112475481 missense possibly damaging 0.89
R7953:Sez6l UTSW 5 112438581 missense probably damaging 1.00
R8260:Sez6l UTSW 5 112461256 missense probably benign 0.23
X0052:Sez6l UTSW 5 112472901 missense possibly damaging 0.75
Z1088:Sez6l UTSW 5 112440915 missense probably damaging 1.00
Z1177:Sez6l UTSW 5 112576932 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTCACAAAACGGCGGGTC -3'
(R):5'- ACCTCAGTGACAGGGTTTCATAG -3'

Sequencing Primer
(F):5'- TCGCTGCTCCAACTGAGGTC -3'
(R):5'- AGCTCAGCGATGCCTTTG -3'
Posted On2019-12-20