Incidental Mutation 'R7870:Nyap1'
ID608039
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Nameneuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms6430598A04Rik, Nyap1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137729899-137741607 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 137735396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 458 (Y458*)
Ref Sequence ENSEMBL: ENSMUSP00000113397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
Predicted Effect probably null
Transcript: ENSMUST00000061789
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118326
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149512
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212152
AA Change: Y458*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137738084 missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137739675 missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137735484 missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137735016 missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137738021 missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137735298 missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137735133 nonsense probably null
R1741:Nyap1 UTSW 5 137733125 missense probably damaging 1.00
R1953:Nyap1 UTSW 5 137735032 missense probably benign 0.01
R2006:Nyap1 UTSW 5 137735691 missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137733681 intron probably null
R2244:Nyap1 UTSW 5 137735314 missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137736022 missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137735578 missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137736114 missense probably damaging 0.99
R5533:Nyap1 UTSW 5 137735464 missense probably benign 0.15
R5695:Nyap1 UTSW 5 137734984 missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137736262 missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137737982 missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137735529 missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137736268 missense probably damaging 1.00
R7658:Nyap1 UTSW 5 137732974 missense probably benign
R7913:Nyap1 UTSW 5 137734969 missense probably damaging 1.00
R7953:Nyap1 UTSW 5 137735396 nonsense probably null
R7994:Nyap1 UTSW 5 137734969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGGATCTTGACCATGG -3'
(R):5'- TATTGCTGGGACCATCAGGC -3'

Sequencing Primer
(F):5'- AACCTCCAGTTGGATCCGGAAG -3'
(R):5'- GGACCATCAGGCCGAGC -3'
Posted On2019-12-20