Incidental Mutation 'R7870:Olfr618'
ID608048
Institutional Source Beutler Lab
Gene Symbol Olfr618
Ensembl Gene ENSMUSG00000073945
Gene Nameolfactory receptor 618
SynonymsMOR31-9, GA_x6K02T2PBJ9-6320148-6321104
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103590103-103600448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103598266 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 317 (C317S)
Ref Sequence ENSEMBL: ENSMUSP00000151147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098197] [ENSMUST00000214883] [ENSMUST00000215732]
Predicted Effect probably damaging
Transcript: ENSMUST00000098197
AA Change: C317S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095799
Gene: ENSMUSG00000073945
AA Change: C317S

DomainStartEndE-ValueType
Pfam:7tm_4 34 314 3.1e-109 PFAM
Pfam:7TM_GPCR_Srsx 38 311 6.3e-12 PFAM
Pfam:7tm_1 44 296 8.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214883
AA Change: C317S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215732
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Olfr618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr618 APN 7 103598162 missense possibly damaging 0.65
IGL00963:Olfr618 APN 7 103597637 unclassified probably null
IGL01772:Olfr618 APN 7 103597913 missense probably benign 0.12
IGL02014:Olfr618 APN 7 103597730 missense probably damaging 1.00
IGL03409:Olfr618 APN 7 103597367 missense possibly damaging 0.51
R0087:Olfr618 UTSW 7 103597721 missense probably benign 0.44
R0831:Olfr618 UTSW 7 103598131 missense probably benign 0.02
R1779:Olfr618 UTSW 7 103597900 missense probably damaging 1.00
R1909:Olfr618 UTSW 7 103597343 missense probably benign 0.01
R5903:Olfr618 UTSW 7 103597921 nonsense probably null
R5952:Olfr618 UTSW 7 103597967 missense probably damaging 1.00
R6328:Olfr618 UTSW 7 103597866 missense probably damaging 1.00
R7264:Olfr618 UTSW 7 103597748 missense probably damaging 0.97
R7573:Olfr618 UTSW 7 103597528 missense probably benign 0.08
R7953:Olfr618 UTSW 7 103598266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGTGGCTCCCATGTCTG -3'
(R):5'- TGGAACAGATATTAAGCCATCCTC -3'

Sequencing Primer
(F):5'- GGCTCCCATGTCTGTGTCATC -3'
(R):5'- TATTAAGCCATCCTCAGACAACTAAG -3'
Posted On2019-12-20