Incidental Mutation 'R7870:Ctr9'
ID608049
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111052411 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 946 (E946G)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect unknown
Transcript: ENSMUST00000005749
AA Change: E946G
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: E946G

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R2851:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
R7371:Ctr9 UTSW 7 111033807 missense probably damaging 0.99
R7391:Ctr9 UTSW 7 111043171 nonsense probably null
R7405:Ctr9 UTSW 7 111043714 missense possibly damaging 0.90
R7406:Ctr9 UTSW 7 111053408 missense unknown
R7502:Ctr9 UTSW 7 111033926 missense probably benign 0.26
R7760:Ctr9 UTSW 7 111046601 missense probably damaging 1.00
R7814:Ctr9 UTSW 7 111033927 missense probably benign 0.08
R7953:Ctr9 UTSW 7 111052411 missense unknown
R8026:Ctr9 UTSW 7 111033892 missense probably damaging 1.00
R8035:Ctr9 UTSW 7 111034457 missense probably damaging 1.00
R8066:Ctr9 UTSW 7 111033897 nonsense probably null
R8080:Ctr9 UTSW 7 111051567 missense possibly damaging 0.91
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTCAGAGACCCGCAAG -3'
(R):5'- TCAGGGACTAACCTAGAGACACATG -3'

Sequencing Primer
(F):5'- CAAGAGCGCTCTCCGGC -3'
(R):5'- AAATGCTCGAGATTCTGAAACAAGC -3'
Posted On2019-12-20