Incidental Mutation 'R7870:Olfr984'
ID608053
Institutional Source Beutler Lab
Gene Symbol Olfr984
Ensembl Gene ENSMUSG00000045812
Gene Nameolfactory receptor 984
SynonymsMOR239-6, GA_x6K02T2PVTD-33799484-33798540
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location40096515-40114206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40100677 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 271 (V271G)
Ref Sequence ENSEMBL: ENSMUSP00000150287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056795] [ENSMUST00000213858] [ENSMUST00000214856] [ENSMUST00000217536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056795
AA Change: V271G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060787
Gene: ENSMUSG00000045812
AA Change: V271G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7tm_1 41 287 6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213858
AA Change: V271G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214856
AA Change: V271G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217536
AA Change: V271G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Olfr984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr984 APN 9 40101154 missense probably benign 0.03
IGL01402:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01404:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01445:Olfr984 APN 9 40101312 missense probably benign 0.45
IGL01448:Olfr984 APN 9 40101082 missense probably damaging 0.97
IGL02598:Olfr984 APN 9 40100565 missense probably benign
IGL03106:Olfr984 APN 9 40100734 missense probably damaging 1.00
R0616:Olfr984 UTSW 9 40100987 missense probably damaging 1.00
R0712:Olfr984 UTSW 9 40101430 missense probably benign
R2049:Olfr984 UTSW 9 40101119 missense probably benign
R2938:Olfr984 UTSW 9 40100743 missense probably benign 0.20
R4609:Olfr984 UTSW 9 40100806 missense possibly damaging 0.81
R4907:Olfr984 UTSW 9 40100659 missense probably benign 0.02
R5001:Olfr984 UTSW 9 40101227 missense probably benign 0.02
R5174:Olfr984 UTSW 9 40100747 missense possibly damaging 0.87
R5587:Olfr984 UTSW 9 40101244 missense probably damaging 1.00
R5880:Olfr984 UTSW 9 40101247 missense possibly damaging 0.95
R5896:Olfr984 UTSW 9 40100893 missense probably damaging 0.99
R6611:Olfr984 UTSW 9 40101020 missense probably benign 0.03
R6904:Olfr984 UTSW 9 40101356 missense probably benign 0.04
R7015:Olfr984 UTSW 9 40101455 missense probably benign 0.30
R7953:Olfr984 UTSW 9 40100677 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTACCCCTGTTCTAGACATCAG -3'
(R):5'- ATGGCTTGGTCACTCTCATG -3'

Sequencing Primer
(F):5'- CCCTGTTCTAGACATCAGAAATTAAC -3'
(R):5'- GTCACTCTCATGTGTTTTCTGGTGC -3'
Posted On2019-12-20