Incidental Mutation 'R7870:Cygb'
ID608061
Institutional Source Beutler Lab
Gene Symbol Cygb
Ensembl Gene ENSMUSG00000020810
Gene Namecytoglobin
Synonyms3110001K20Rik, Staap
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116645595-116654313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116649290 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 178 (T178S)
Ref Sequence ENSEMBL: ENSMUSP00000021166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021166] [ENSMUST00000106381] [ENSMUST00000148484] [ENSMUST00000178875]
Predicted Effect probably benign
Transcript: ENSMUST00000021166
AA Change: T178S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021166
Gene: ENSMUSG00000020810
AA Change: T178S

DomainStartEndE-ValueType
Pfam:Globin 23 132 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106381
SMART Domains Protein: ENSMUSP00000101989
Gene: ENSMUSG00000075410

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148484
SMART Domains Protein: ENSMUSP00000119671
Gene: ENSMUSG00000075410

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178875
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display increased sensitivity to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Cygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Cygb APN 11 116649923 missense probably damaging 1.00
R2129:Cygb UTSW 11 116649842 missense probably damaging 1.00
R2567:Cygb UTSW 11 116649866 missense probably damaging 0.99
R5016:Cygb UTSW 11 116650014 missense probably benign 0.19
R7070:Cygb UTSW 11 116654025 intron probably benign
R7953:Cygb UTSW 11 116649290 missense probably benign 0.00
R8125:Cygb UTSW 11 116649290 missense probably benign 0.00
X0026:Cygb UTSW 11 116649365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTGTGTAGCCAAGAGTC -3'
(R):5'- ACAAGCCAGTGTGACCCTAG -3'

Sequencing Primer
(F):5'- CTGTGTAGCCAAGAGTCAGGGC -3'
(R):5'- AGGGTGCTCAGGCGCTTAC -3'
Posted On2019-12-20