Incidental Mutation 'R7870:Nisch'
ID608065
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31172095 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1174 (Y1174H)
Ref Sequence ENSEMBL: ENSMUSP00000132842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000036618] [ENSMUST00000167449] [ENSMUST00000168206] [ENSMUST00000169628]
Predicted Effect probably damaging
Transcript: ENSMUST00000022469
AA Change: Y1419H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910
AA Change: Y1419H

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167449
Predicted Effect probably damaging
Transcript: ENSMUST00000168206
AA Change: Y1174H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910
AA Change: Y1174H

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169628
SMART Domains Protein: ENSMUSP00000131465
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 231 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170253
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 intron probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7887:Nisch UTSW 14 31176695 nonsense probably null
R7953:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7970:Nisch UTSW 14 31176695 nonsense probably null
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCGTCTAGCCGGTATCTGTC -3'
(R):5'- GACTACTCTCATTATGTGGGGCTG -3'

Sequencing Primer
(F):5'- GCTCTTTGGCAAATTCAGGC -3'
(R):5'- GCTGTTTCTTTTGACTGCACCAC -3'
Posted On2019-12-20