Incidental Mutation 'R7870:Sema5a'
ID608069
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32609339 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 464 (I464F)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably benign
Transcript: ENSMUST00000067458
AA Change: I464F

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: I464F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0413:Sema5a UTSW 15 32669444 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1550:Sema5a UTSW 15 32618849 missense probably benign 0.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2062:Sema5a UTSW 15 32609217 splice site probably benign
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6220:Sema5a UTSW 15 32686729 missense probably damaging 0.99
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32417462 missense probably benign
R7572:Sema5a UTSW 15 32673428 missense probably damaging 1.00
R7621:Sema5a UTSW 15 32609232 missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32682325 missense probably damaging 0.97
R7880:Sema5a UTSW 15 32686808 missense probably damaging 1.00
R7953:Sema5a UTSW 15 32609339 missense probably benign 0.23
R7963:Sema5a UTSW 15 32686808 missense probably damaging 1.00
R8025:Sema5a UTSW 15 32548782 missense probably benign 0.37
R8034:Sema5a UTSW 15 32574841 missense probably damaging 1.00
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGTGCTACCTGTGTG -3'
(R):5'- TCCAGAGGTTAGTGGCATCAC -3'

Sequencing Primer
(F):5'- GTGCTACCTGTGTGCTCTATTTTC -3'
(R):5'- TTCAATGAAGACCCTGTGTCCCAG -3'
Posted On2019-12-20