Incidental Mutation 'R7870:Zfp598'
ID608074
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7870 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24679330 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 402 (E402G)
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047179]
Predicted Effect probably damaging
Transcript: ENSMUST00000047179
AA Change: E402G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130
AA Change: E402G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rax A G 18: 65,938,213 V117A probably benign Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp354c TGTCACACTCG TG 11: 50,815,238 probably benign Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1523:Zfp598 UTSW 17 24678629 missense probably null 1.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R2080:Zfp598 UTSW 17 24679667 missense probably damaging 1.00
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R5923:Zfp598 UTSW 17 24677549 missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
R7438:Zfp598 UTSW 17 24677530 missense probably damaging 1.00
R7953:Zfp598 UTSW 17 24679330 missense probably damaging 0.98
RF009:Zfp598 UTSW 17 24680787 small insertion probably benign
RF016:Zfp598 UTSW 17 24680771 small insertion probably benign
RF018:Zfp598 UTSW 17 24680771 small insertion probably benign
RF053:Zfp598 UTSW 17 24680761 small insertion probably benign
RF058:Zfp598 UTSW 17 24680761 small insertion probably benign
RF061:Zfp598 UTSW 17 24680770 small insertion probably benign
RF064:Zfp598 UTSW 17 24680783 small insertion probably benign
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Z1177:Zfp598 UTSW 17 24679639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTGGCAGCTGCTATCC -3'
(R):5'- AAGTCTTCCTCCTTGAGCTCAG -3'

Sequencing Primer
(F):5'- TGCTATCCGGGCCTCTGTG -3'
(R):5'- TGGGAGGGTACTGGGTCCAAG -3'
Posted On2019-12-20