Incidental Mutation 'R7871:Dennd1b'
ID608086
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7871 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139062873 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 192 (E192K)
Ref Sequence ENSEMBL: ENSMUSP00000142738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000198759] [ENSMUST00000200429] [ENSMUST00000200533]
Predicted Effect
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: E97K

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198759
Predicted Effect probably damaging
Transcript: ENSMUST00000200429
AA Change: E172K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200533
AA Change: E192K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142738
Gene: ENSMUSG00000056268
AA Change: E192K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 232 4.61e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,183,226 S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,038 probably null Het
Arpin A T 7: 79,927,715 W195R probably damaging Het
Asap1 A G 15: 64,092,076 V1091A probably damaging Het
Asxl3 A G 18: 22,524,224 T1764A not run Het
Bmp7 C A 2: 172,939,991 A27S probably benign Het
Ccnh T A 13: 85,211,872 Y297* probably null Het
Ccno C A 13: 112,988,113 D72E probably benign Het
Cd70 T G 17: 57,148,770 T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,687,400 probably null Het
Chst4 A G 8: 110,030,913 F106S probably damaging Het
Cntnap3 A C 13: 64,903,773 L23R probably benign Het
Crybg2 T A 4: 134,087,599 L1288H probably damaging Het
Cyfip2 T C 11: 46,242,350 H841R probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp4f18 G A 8: 71,988,643 P498S possibly damaging Het
Dnah3 T A 7: 119,967,552 I97F Het
Entpd3 A G 9: 120,560,586 R313G possibly damaging Het
Erg28 G A 12: 85,819,479 T75I probably damaging Het
Fam171a1 A G 2: 3,225,384 H518R probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Galntl6 T C 8: 57,837,188 E457G probably damaging Het
Glt8d1 A T 14: 31,010,339 H192L probably damaging Het
Gm15446 T A 5: 109,943,299 C472* probably null Het
Gm28363 A T 1: 117,697,498 M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gstp3 T A 19: 4,058,746 K45* probably null Het
Hsd17b13 A G 5: 103,965,815 F258L possibly damaging Het
Htt T C 5: 34,864,649 S1646P probably benign Het
Ipo11 T C 13: 106,892,468 M326V probably benign Het
Itpr3 T A 17: 27,117,179 I2293N probably damaging Het
Kntc1 T A 5: 123,784,227 L963H probably damaging Het
Lyst T A 13: 13,636,052 L769* probably null Het
Map3k13 A G 16: 21,921,596 S558G probably benign Het
Mbd1 G A 18: 74,274,057 probably null Het
Mep1a T C 17: 43,479,235 N408D probably benign Het
Mtrf1 A G 14: 79,406,938 T229A probably benign Het
Muc4 C T 16: 32,754,935 S1603L unknown Het
Myo1b A C 1: 51,779,580 I512S possibly damaging Het
N4bp2 A G 5: 65,807,103 I832V probably benign Het
Nadsyn1 T A 7: 143,798,496 K618* probably null Het
Ncstn T C 1: 172,075,456 D87G probably benign Het
Neurl4 T C 11: 69,903,186 V156A probably benign Het
Nfasc C A 1: 132,600,013 G885V not run Het
Nox4 A T 7: 87,314,127 Y180F possibly damaging Het
Nuggc A G 14: 65,623,251 T449A probably benign Het
Olfr799 A G 10: 129,647,412 I95V probably benign Het
Pik3r4 T C 9: 105,663,117 S735P probably damaging Het
Ppp1r9b T C 11: 95,001,909 I645T probably damaging Het
Rras2 G A 7: 114,117,548 probably benign Het
Rtel1 T C 2: 181,321,029 M25T probably damaging Het
Serpinb3c T A 1: 107,273,153 Y178F possibly damaging Het
Sh3bp2 A G 5: 34,559,085 H280R not run Het
Six4 CT C 12: 73,104,239 probably benign Het
Skor1 T C 9: 63,146,501 E62G probably damaging Het
Slc22a22 T A 15: 57,263,355 N106I possibly damaging Het
Slc44a4 T A 17: 34,923,852 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stx5a T A 19: 8,755,118 W384R unknown Het
Topaz1 A G 9: 122,780,700 Y1111C possibly damaging Het
Ttbk1 T A 17: 46,446,238 M1157L probably benign Het
Ttn T C 2: 76,717,215 T32204A probably benign Het
Ttn T C 2: 76,748,145 T24135A probably damaging Het
Ttn T C 2: 76,965,137 E632G unknown Het
Vmn2r109 T C 17: 20,540,520 I858M probably benign Het
Vmn2r71 A T 7: 85,623,661 Q561L possibly damaging Het
Yme1l1 A G 2: 23,181,065 D271G probably damaging Het
Zfp629 A G 7: 127,611,995 F214S probably damaging Het
Zfp709 A G 8: 71,889,464 I246V probably benign Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 intron probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7742:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7796:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7954:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R8025:Dennd1b UTSW 1 139110420 missense
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATTGGGTACAAAAGATGG -3'
(R):5'- AAATGTGCAGACGTGTTTAGGTC -3'

Sequencing Primer
(F):5'- AGATGGTATTATTAGAAGTGGCATTC -3'
(R):5'- GGTCTTTTTGTGAAGCACTCAATATG -3'
Posted On2019-12-20