Incidental Mutation 'R7871:Fam171a1'
ID 608089
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms 9630050M13Rik
MMRRC Submission 045923-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7871 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3115261-3228843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3226421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 518 (H518R)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: H513R

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: H513R

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: H393R

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: H393R

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: H518R

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: H518R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,331,092 (GRCm39) S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,361,864 (GRCm39) probably null Het
Arpin A T 7: 79,577,463 (GRCm39) W195R probably damaging Het
Asap1 A G 15: 63,963,925 (GRCm39) V1091A probably damaging Het
Asxl3 A G 18: 22,657,281 (GRCm39) T1764A not run Het
Bmp7 C A 2: 172,781,784 (GRCm39) A27S probably benign Het
Ccnh T A 13: 85,359,991 (GRCm39) Y297* probably null Het
Ccno C A 13: 113,124,647 (GRCm39) D72E probably benign Het
Cd70 T G 17: 57,455,770 (GRCm39) T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,514,966 (GRCm39) probably null Het
Chst4 A G 8: 110,757,545 (GRCm39) F106S probably damaging Het
Cntnap3 A C 13: 65,051,587 (GRCm39) L23R probably benign Het
Crybg2 T A 4: 133,814,910 (GRCm39) L1288H probably damaging Het
Cse1l T A 2: 166,777,591 (GRCm39) probably null Het
Cyfip2 T C 11: 46,133,177 (GRCm39) H841R probably damaging Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp4f18 G A 8: 72,742,487 (GRCm39) P498S possibly damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dnah3 T A 7: 119,566,775 (GRCm39) I97F Het
Entpd3 A G 9: 120,389,652 (GRCm39) R313G possibly damaging Het
Erg28 G A 12: 85,866,253 (GRCm39) T75I probably damaging Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Galntl6 T C 8: 58,290,222 (GRCm39) E457G probably damaging Het
Glt8d1 A T 14: 30,732,296 (GRCm39) H192L probably damaging Het
Gm15446 T A 5: 110,091,165 (GRCm39) C472* probably null Het
Gm28363 A T 1: 117,625,228 (GRCm39) M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gstp3 T A 19: 4,108,746 (GRCm39) K45* probably null Het
Hsd17b13 A G 5: 104,113,681 (GRCm39) F258L possibly damaging Het
Htt T C 5: 35,021,993 (GRCm39) S1646P probably benign Het
Ipo11 T C 13: 107,028,976 (GRCm39) M326V probably benign Het
Itpr3 T A 17: 27,336,153 (GRCm39) I2293N probably damaging Het
Klk1b8 A G 7: 43,448,750 (GRCm39) probably null Het
Kntc1 T A 5: 123,922,290 (GRCm39) L963H probably damaging Het
Lyst T A 13: 13,810,637 (GRCm39) L769* probably null Het
Map3k13 A G 16: 21,740,346 (GRCm39) S558G probably benign Het
Mbd1 G A 18: 74,407,128 (GRCm39) probably null Het
Mep1a T C 17: 43,790,126 (GRCm39) N408D probably benign Het
Mtrf1 A G 14: 79,644,378 (GRCm39) T229A probably benign Het
Muc4 C T 16: 32,754,935 (GRCm38) S1603L unknown Het
Myo1b A C 1: 51,818,739 (GRCm39) I512S possibly damaging Het
N4bp2 A G 5: 65,964,446 (GRCm39) I832V probably benign Het
Nadsyn1 T A 7: 143,352,233 (GRCm39) K618* probably null Het
Ncstn T C 1: 171,903,023 (GRCm39) D87G probably benign Het
Neurl4 T C 11: 69,794,012 (GRCm39) V156A probably benign Het
Nfasc C A 1: 132,527,751 (GRCm39) G885V not run Het
Nox4 A T 7: 86,963,335 (GRCm39) Y180F possibly damaging Het
Nuggc A G 14: 65,860,700 (GRCm39) T449A probably benign Het
Or6c209 A G 10: 129,483,281 (GRCm39) I95V probably benign Het
Pik3r4 T C 9: 105,540,316 (GRCm39) S735P probably damaging Het
Ppp1r9b T C 11: 94,892,735 (GRCm39) I645T probably damaging Het
Rras2 G A 7: 113,716,783 (GRCm39) probably benign Het
Rtel1 T C 2: 180,962,822 (GRCm39) M25T probably damaging Het
Serpinb3c T A 1: 107,200,883 (GRCm39) Y178F possibly damaging Het
Sh3bp2 A G 5: 34,716,429 (GRCm39) H280R not run Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Skor1 T C 9: 63,053,783 (GRCm39) E62G probably damaging Het
Slc22a22 T A 15: 57,126,751 (GRCm39) N106I possibly damaging Het
Slc44a4 T A 17: 35,142,828 (GRCm39) probably null Het
Sppl2c A G 11: 104,079,342 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stx5a T A 19: 8,732,482 (GRCm39) W384R unknown Het
Topaz1 A G 9: 122,609,765 (GRCm39) Y1111C possibly damaging Het
Ttbk1 T A 17: 46,757,164 (GRCm39) M1157L probably benign Het
Ttn T C 2: 76,578,489 (GRCm39) T24135A probably damaging Het
Ttn T C 2: 76,795,481 (GRCm39) E632G unknown Het
Ttn T C 2: 76,547,559 (GRCm39) T32204A probably benign Het
Vmn2r109 T C 17: 20,760,782 (GRCm39) I858M probably benign Het
Vmn2r71 A T 7: 85,272,869 (GRCm39) Q561L possibly damaging Het
Yme1l1 A G 2: 23,071,077 (GRCm39) D271G probably damaging Het
Zfp629 A G 7: 127,211,167 (GRCm39) F214S probably damaging Het
Zfp709 A G 8: 72,643,308 (GRCm39) I246V probably benign Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3,179,327 (GRCm39) missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3,203,657 (GRCm39) missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3,203,663 (GRCm39) missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3,224,623 (GRCm39) critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3,224,527 (GRCm39) missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3,203,612 (GRCm39) missense possibly damaging 0.83
ghosted UTSW 2 3,226,189 (GRCm39) nonsense probably null
R0167:Fam171a1 UTSW 2 3,187,469 (GRCm39) missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0468:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0811:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3,226,354 (GRCm39) missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3,226,660 (GRCm39) missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3,179,410 (GRCm39) missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3,227,189 (GRCm39) missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3,221,380 (GRCm39) missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3,226,656 (GRCm39) nonsense probably null
R2355:Fam171a1 UTSW 2 3,226,570 (GRCm39) nonsense probably null
R3690:Fam171a1 UTSW 2 3,227,393 (GRCm39) missense probably benign
R3723:Fam171a1 UTSW 2 3,221,412 (GRCm39) splice site probably benign
R3978:Fam171a1 UTSW 2 3,226,072 (GRCm39) missense probably benign
R4087:Fam171a1 UTSW 2 3,227,333 (GRCm39) missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3,221,328 (GRCm39) missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3,225,946 (GRCm39) missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3,224,550 (GRCm39) missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3,226,615 (GRCm39) missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3,224,546 (GRCm39) missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3,179,505 (GRCm39) splice site probably null
R5137:Fam171a1 UTSW 2 3,226,426 (GRCm39) missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3,224,582 (GRCm39) missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3,179,390 (GRCm39) missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3,226,654 (GRCm39) missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3,226,334 (GRCm39) missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3,227,126 (GRCm39) missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3,226,374 (GRCm39) missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3,227,392 (GRCm39) missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3,224,512 (GRCm39) missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3,226,189 (GRCm39) nonsense probably null
R7155:Fam171a1 UTSW 2 3,226,766 (GRCm39) missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3,119,653 (GRCm39) missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3,227,509 (GRCm39) nonsense probably null
R7477:Fam171a1 UTSW 2 3,226,676 (GRCm39) missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3,221,391 (GRCm39) missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3,226,483 (GRCm39) missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3,179,354 (GRCm39) missense probably damaging 0.98
R7958:Fam171a1 UTSW 2 3,179,298 (GRCm39) missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3,221,352 (GRCm39) missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3,187,535 (GRCm39) missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3,221,344 (GRCm39) missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3,226,940 (GRCm39) missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3,227,434 (GRCm39) missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3,226,525 (GRCm39) missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3,226,037 (GRCm39) missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3,226,630 (GRCm39) missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3,225,971 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AACTTAACGCCAAGTGGGAC -3'
(R):5'- GCAATACTTTCCTGTAAACGCTGTC -3'

Sequencing Primer
(F):5'- ACCATAAGTCTGTGGAGATTTTTCCC -3'
(R):5'- GTCATTGACTTGGTCCACAGAAC -3'
Posted On 2019-12-20