Incidental Mutation 'R7871:Ipo11'
ID 608131
Institutional Source Beutler Lab
Gene Symbol Ipo11
Ensembl Gene ENSMUSG00000042590
Gene Name importin 11
Synonyms Ranbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7871 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 106794439-106936958 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106892468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 326 (M326V)
Ref Sequence ENSEMBL: ENSMUSP00000079667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]
AlphaFold Q8K2V6
Predicted Effect probably benign
Transcript: ENSMUST00000080856
AA Change: M326V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590
AA Change: M326V

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186033
AA Change: M326V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590
AA Change: M326V

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,183,226 S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,038 probably null Het
Arpin A T 7: 79,927,715 W195R probably damaging Het
Asap1 A G 15: 64,092,076 V1091A probably damaging Het
Asxl3 A G 18: 22,524,224 T1764A not run Het
Bmp7 C A 2: 172,939,991 A27S probably benign Het
Ccnh T A 13: 85,211,872 Y297* probably null Het
Ccno C A 13: 112,988,113 D72E probably benign Het
Cd70 T G 17: 57,148,770 T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,687,400 probably null Het
Chst4 A G 8: 110,030,913 F106S probably damaging Het
Cntnap3 A C 13: 64,903,773 L23R probably benign Het
Crybg2 T A 4: 134,087,599 L1288H probably damaging Het
Cse1l T A 2: 166,935,671 probably null Het
Cyfip2 T C 11: 46,242,350 H841R probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp4f18 G A 8: 71,988,643 P498S possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dnah3 T A 7: 119,967,552 I97F Het
Entpd3 A G 9: 120,560,586 R313G possibly damaging Het
Erg28 G A 12: 85,819,479 T75I probably damaging Het
Fam171a1 A G 2: 3,225,384 H518R probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Galntl6 T C 8: 57,837,188 E457G probably damaging Het
Glt8d1 A T 14: 31,010,339 H192L probably damaging Het
Gm15446 T A 5: 109,943,299 C472* probably null Het
Gm28363 A T 1: 117,697,498 M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gstp3 T A 19: 4,058,746 K45* probably null Het
Hsd17b13 A G 5: 103,965,815 F258L possibly damaging Het
Htt T C 5: 34,864,649 S1646P probably benign Het
Itpr3 T A 17: 27,117,179 I2293N probably damaging Het
Klk8 A G 7: 43,799,326 probably null Het
Kntc1 T A 5: 123,784,227 L963H probably damaging Het
Lyst T A 13: 13,636,052 L769* probably null Het
Map3k13 A G 16: 21,921,596 S558G probably benign Het
Mbd1 G A 18: 74,274,057 probably null Het
Mep1a T C 17: 43,479,235 N408D probably benign Het
Mtrf1 A G 14: 79,406,938 T229A probably benign Het
Muc4 C T 16: 32,754,935 S1603L unknown Het
Myo1b A C 1: 51,779,580 I512S possibly damaging Het
N4bp2 A G 5: 65,807,103 I832V probably benign Het
Nadsyn1 T A 7: 143,798,496 K618* probably null Het
Ncstn T C 1: 172,075,456 D87G probably benign Het
Neurl4 T C 11: 69,903,186 V156A probably benign Het
Nfasc C A 1: 132,600,013 G885V not run Het
Nox4 A T 7: 87,314,127 Y180F possibly damaging Het
Nuggc A G 14: 65,623,251 T449A probably benign Het
Olfr799 A G 10: 129,647,412 I95V probably benign Het
Pik3r4 T C 9: 105,663,117 S735P probably damaging Het
Ppp1r9b T C 11: 95,001,909 I645T probably damaging Het
Rras2 G A 7: 114,117,548 probably benign Het
Rtel1 T C 2: 181,321,029 M25T probably damaging Het
Serpinb3c T A 1: 107,273,153 Y178F possibly damaging Het
Sh3bp2 A G 5: 34,559,085 H280R not run Het
Six4 CT C 12: 73,104,239 probably benign Het
Skor1 T C 9: 63,146,501 E62G probably damaging Het
Slc22a22 T A 15: 57,263,355 N106I possibly damaging Het
Slc44a4 T A 17: 34,923,852 probably null Het
Sppl2c A G 11: 104,188,516 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stx5a T A 19: 8,755,118 W384R unknown Het
Topaz1 A G 9: 122,780,700 Y1111C possibly damaging Het
Ttbk1 T A 17: 46,446,238 M1157L probably benign Het
Ttn T C 2: 76,717,215 T32204A probably benign Het
Ttn T C 2: 76,748,145 T24135A probably damaging Het
Ttn T C 2: 76,965,137 E632G unknown Het
Vmn2r109 T C 17: 20,540,520 I858M probably benign Het
Vmn2r71 A T 7: 85,623,661 Q561L possibly damaging Het
Yme1l1 A G 2: 23,181,065 D271G probably damaging Het
Zfp629 A G 7: 127,611,995 F214S probably damaging Het
Zfp709 A G 8: 71,889,464 I246V probably benign Het
Other mutations in Ipo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ipo11 APN 13 106897260 missense probably damaging 1.00
IGL00900:Ipo11 APN 13 106847444 missense possibly damaging 0.81
IGL00971:Ipo11 APN 13 106856769 missense probably damaging 1.00
IGL01023:Ipo11 APN 13 106897259 missense probably benign 0.44
IGL01331:Ipo11 APN 13 106795746 missense possibly damaging 0.92
IGL01608:Ipo11 APN 13 106834494 intron probably benign
IGL02021:Ipo11 APN 13 106857237 missense probably damaging 1.00
IGL02620:Ipo11 APN 13 106876281 critical splice acceptor site probably null
IGL02651:Ipo11 APN 13 106875606 missense probably damaging 1.00
IGL02699:Ipo11 APN 13 106889397 missense possibly damaging 0.94
IGL02928:Ipo11 APN 13 106889355 splice site probably benign
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0032:Ipo11 UTSW 13 106834463 intron probably benign
R0164:Ipo11 UTSW 13 106910194 splice site probably benign
R0333:Ipo11 UTSW 13 106870763 missense probably benign 0.00
R0499:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R0555:Ipo11 UTSW 13 106892461 missense probably damaging 1.00
R0718:Ipo11 UTSW 13 106919611 missense possibly damaging 0.91
R0899:Ipo11 UTSW 13 106900816 nonsense probably null
R1590:Ipo11 UTSW 13 106886717 missense probably damaging 1.00
R1700:Ipo11 UTSW 13 106795662 missense probably benign
R1851:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1852:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1853:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R2012:Ipo11 UTSW 13 106919622 missense probably benign 0.01
R2168:Ipo11 UTSW 13 106879610 splice site probably null
R2183:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R4254:Ipo11 UTSW 13 106892509 missense probably benign 0.00
R4607:Ipo11 UTSW 13 106900811 missense probably damaging 0.98
R4610:Ipo11 UTSW 13 106879737 missense probably benign 0.06
R4654:Ipo11 UTSW 13 106834184 intron probably benign
R4792:Ipo11 UTSW 13 106834160 intron probably benign
R4990:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R5309:Ipo11 UTSW 13 106833973 intron probably benign
R5580:Ipo11 UTSW 13 106900747 missense probably benign
R5822:Ipo11 UTSW 13 106848418 unclassified probably benign
R6459:Ipo11 UTSW 13 106865769 splice site probably null
R6597:Ipo11 UTSW 13 106865863 critical splice donor site probably null
R6803:Ipo11 UTSW 13 106857258 missense probably benign
R6882:Ipo11 UTSW 13 106900682 splice site probably null
R7071:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R7202:Ipo11 UTSW 13 106875570 missense probably damaging 1.00
R7214:Ipo11 UTSW 13 106895857 missense probably null
R7221:Ipo11 UTSW 13 106892557 missense probably damaging 1.00
R7392:Ipo11 UTSW 13 106891691 nonsense probably null
R8189:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R8426:Ipo11 UTSW 13 106842170 missense possibly damaging 0.92
R8951:Ipo11 UTSW 13 106842182 missense possibly damaging 0.80
R8981:Ipo11 UTSW 13 106925125 missense probably benign 0.18
R9272:Ipo11 UTSW 13 106910205 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCCCTTTAAAAGCCAGTATTCAC -3'
(R):5'- GTCCCAGGAAGTTTACATCTGG -3'

Sequencing Primer
(F):5'- AGCCAGTATTCACACATTAAACTG -3'
(R):5'- CCCAGGAAGTTTACATCTGGTTAAAC -3'
Posted On 2019-12-20