Incidental Mutation 'R7871:Mtrf1'
ID 608135
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms A830062K05Rik
MMRRC Submission 045923-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7871 (G1)
Quality Score 112.008
Status Validated
Chromosome 14
Chromosomal Location 79635212-79661027 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79644378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
AlphaFold Q8K126
Predicted Effect probably benign
Transcript: ENSMUST00000022600
AA Change: T229A

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: T229A

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,331,092 (GRCm39) S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,361,864 (GRCm39) probably null Het
Arpin A T 7: 79,577,463 (GRCm39) W195R probably damaging Het
Asap1 A G 15: 63,963,925 (GRCm39) V1091A probably damaging Het
Asxl3 A G 18: 22,657,281 (GRCm39) T1764A not run Het
Bmp7 C A 2: 172,781,784 (GRCm39) A27S probably benign Het
Ccnh T A 13: 85,359,991 (GRCm39) Y297* probably null Het
Ccno C A 13: 113,124,647 (GRCm39) D72E probably benign Het
Cd70 T G 17: 57,455,770 (GRCm39) T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,514,966 (GRCm39) probably null Het
Chst4 A G 8: 110,757,545 (GRCm39) F106S probably damaging Het
Cntnap3 A C 13: 65,051,587 (GRCm39) L23R probably benign Het
Crybg2 T A 4: 133,814,910 (GRCm39) L1288H probably damaging Het
Cse1l T A 2: 166,777,591 (GRCm39) probably null Het
Cyfip2 T C 11: 46,133,177 (GRCm39) H841R probably damaging Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp4f18 G A 8: 72,742,487 (GRCm39) P498S possibly damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dnah3 T A 7: 119,566,775 (GRCm39) I97F Het
Entpd3 A G 9: 120,389,652 (GRCm39) R313G possibly damaging Het
Erg28 G A 12: 85,866,253 (GRCm39) T75I probably damaging Het
Fam171a1 A G 2: 3,226,421 (GRCm39) H518R probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Galntl6 T C 8: 58,290,222 (GRCm39) E457G probably damaging Het
Glt8d1 A T 14: 30,732,296 (GRCm39) H192L probably damaging Het
Gm15446 T A 5: 110,091,165 (GRCm39) C472* probably null Het
Gm28363 A T 1: 117,625,228 (GRCm39) M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gstp3 T A 19: 4,108,746 (GRCm39) K45* probably null Het
Hsd17b13 A G 5: 104,113,681 (GRCm39) F258L possibly damaging Het
Htt T C 5: 35,021,993 (GRCm39) S1646P probably benign Het
Ipo11 T C 13: 107,028,976 (GRCm39) M326V probably benign Het
Itpr3 T A 17: 27,336,153 (GRCm39) I2293N probably damaging Het
Klk1b8 A G 7: 43,448,750 (GRCm39) probably null Het
Kntc1 T A 5: 123,922,290 (GRCm39) L963H probably damaging Het
Lyst T A 13: 13,810,637 (GRCm39) L769* probably null Het
Map3k13 A G 16: 21,740,346 (GRCm39) S558G probably benign Het
Mbd1 G A 18: 74,407,128 (GRCm39) probably null Het
Mep1a T C 17: 43,790,126 (GRCm39) N408D probably benign Het
Muc4 C T 16: 32,754,935 (GRCm38) S1603L unknown Het
Myo1b A C 1: 51,818,739 (GRCm39) I512S possibly damaging Het
N4bp2 A G 5: 65,964,446 (GRCm39) I832V probably benign Het
Nadsyn1 T A 7: 143,352,233 (GRCm39) K618* probably null Het
Ncstn T C 1: 171,903,023 (GRCm39) D87G probably benign Het
Neurl4 T C 11: 69,794,012 (GRCm39) V156A probably benign Het
Nfasc C A 1: 132,527,751 (GRCm39) G885V not run Het
Nox4 A T 7: 86,963,335 (GRCm39) Y180F possibly damaging Het
Nuggc A G 14: 65,860,700 (GRCm39) T449A probably benign Het
Or6c209 A G 10: 129,483,281 (GRCm39) I95V probably benign Het
Pik3r4 T C 9: 105,540,316 (GRCm39) S735P probably damaging Het
Ppp1r9b T C 11: 94,892,735 (GRCm39) I645T probably damaging Het
Rras2 G A 7: 113,716,783 (GRCm39) probably benign Het
Rtel1 T C 2: 180,962,822 (GRCm39) M25T probably damaging Het
Serpinb3c T A 1: 107,200,883 (GRCm39) Y178F possibly damaging Het
Sh3bp2 A G 5: 34,716,429 (GRCm39) H280R not run Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Skor1 T C 9: 63,053,783 (GRCm39) E62G probably damaging Het
Slc22a22 T A 15: 57,126,751 (GRCm39) N106I possibly damaging Het
Slc44a4 T A 17: 35,142,828 (GRCm39) probably null Het
Sppl2c A G 11: 104,079,342 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stx5a T A 19: 8,732,482 (GRCm39) W384R unknown Het
Topaz1 A G 9: 122,609,765 (GRCm39) Y1111C possibly damaging Het
Ttbk1 T A 17: 46,757,164 (GRCm39) M1157L probably benign Het
Ttn T C 2: 76,578,489 (GRCm39) T24135A probably damaging Het
Ttn T C 2: 76,795,481 (GRCm39) E632G unknown Het
Ttn T C 2: 76,547,559 (GRCm39) T32204A probably benign Het
Vmn2r109 T C 17: 20,760,782 (GRCm39) I858M probably benign Het
Vmn2r71 A T 7: 85,272,869 (GRCm39) Q561L possibly damaging Het
Yme1l1 A G 2: 23,071,077 (GRCm39) D271G probably damaging Het
Zfp629 A G 7: 127,211,167 (GRCm39) F214S probably damaging Het
Zfp709 A G 8: 72,643,308 (GRCm39) I246V probably benign Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79,660,865 (GRCm39) missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79,640,360 (GRCm39) splice site probably benign
IGL01866:Mtrf1 APN 14 79,638,948 (GRCm39) missense probably benign
IGL02290:Mtrf1 APN 14 79,639,251 (GRCm39) nonsense probably null
IGL02929:Mtrf1 APN 14 79,640,273 (GRCm39) missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79,653,312 (GRCm39) splice site probably null
IGL03342:Mtrf1 APN 14 79,653,311 (GRCm39) splice site probably benign
IGL03342:Mtrf1 APN 14 79,653,420 (GRCm39) missense possibly damaging 0.80
R0212:Mtrf1 UTSW 14 79,656,719 (GRCm39) missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79,644,290 (GRCm39) missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79,653,327 (GRCm39) missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79,656,708 (GRCm39) nonsense probably null
R0981:Mtrf1 UTSW 14 79,639,030 (GRCm39) missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79,639,273 (GRCm39) missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79,639,111 (GRCm39) missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79,656,707 (GRCm39) missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79,650,520 (GRCm39) missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79,649,090 (GRCm39) missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79,639,128 (GRCm39) missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79,644,027 (GRCm39) missense probably benign
R5616:Mtrf1 UTSW 14 79,638,885 (GRCm39) missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79,640,331 (GRCm39) missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79,650,521 (GRCm39) missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79,660,931 (GRCm39) frame shift probably null
R7182:Mtrf1 UTSW 14 79,660,904 (GRCm39) missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79,660,931 (GRCm39) frame shift probably null
R8249:Mtrf1 UTSW 14 79,638,919 (GRCm39) missense probably benign 0.23
R9593:Mtrf1 UTSW 14 79,656,664 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGGACATGCCCATTTCCTG -3'
(R):5'- CCAGCAGACAGAACTTATAGGTC -3'

Sequencing Primer
(F):5'- TGGGTGCTCACGCCTAAG -3'
(R):5'- GATCCTCCAGAAGAGTGACTATTGC -3'
Posted On 2019-12-20