Incidental Mutation 'R0147:Ctcfl'
ID60814
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene NameCCCTC-binding factor (zinc finger protein)-like
SynonymsBoris, OTTMUSG00000016680
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0147 (G1)
Quality Score189
Status Validated
Chromosome2
Chromosomal Location173093609-173119525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173118547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 81 (D81G)
Ref Sequence ENSEMBL: ENSMUSP00000135932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094287
AA Change: D81G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: D81G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144256
Predicted Effect possibly damaging
Transcript: ENSMUST00000179693
AA Change: D81G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: D81G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 173094734 missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 173118331 missense probably benign 0.03
IGL01524:Ctcfl APN 2 173117384 missense probably benign 0.08
IGL02610:Ctcfl APN 2 173106026 splice site probably benign
IGL02961:Ctcfl APN 2 173101919 missense possibly damaging 0.70
R0148:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 173118443 missense probably damaging 0.99
R1099:Ctcfl UTSW 2 173112360 missense probably damaging 1.00
R1540:Ctcfl UTSW 2 173112348 missense probably benign 0.36
R1892:Ctcfl UTSW 2 173118685 missense probably benign 0.24
R2036:Ctcfl UTSW 2 173101985 missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 173118506 missense probably benign 0.00
R2925:Ctcfl UTSW 2 173094696 missense probably damaging 1.00
R4327:Ctcfl UTSW 2 173113506 intron probably benign
R4837:Ctcfl UTSW 2 173113656 missense probably benign 0.00
R4894:Ctcfl UTSW 2 173117403 missense probably benign 0.19
R4909:Ctcfl UTSW 2 173095398 missense probably benign 0.42
R5128:Ctcfl UTSW 2 173117396 missense probably benign 0.00
R5247:Ctcfl UTSW 2 173113609 missense probably damaging 1.00
R6263:Ctcfl UTSW 2 173095337 missense probably benign 0.00
R6768:Ctcfl UTSW 2 173117291 missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 173112374 missense probably damaging 1.00
R7180:Ctcfl UTSW 2 173105977 intron probably null
R7256:Ctcfl UTSW 2 173118475 missense probably benign 0.01
R7268:Ctcfl UTSW 2 173107795 missense probably benign 0.26
R7378:Ctcfl UTSW 2 173112258 missense probably damaging 1.00
R7560:Ctcfl UTSW 2 173118406 missense probably damaging 0.96
R7657:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 173117192 missense probably benign
Z1088:Ctcfl UTSW 2 173118344 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCGTCACGCAATGCTGAAG -3'
(R):5'- TCAAAGCCCATGTCTACTAGGCCC -3'

Sequencing Primer
(F):5'- CAATGCTGAAGGCTGAGCTG -3'
(R):5'- TGGGTACTTCACCCAGATCAAAG -3'
Posted On2013-07-24