Incidental Mutation 'R7871:Asxl3'
ID 608146
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Name ASXL transcriptional regulator 3
Synonyms D430002O22Rik, C230079D11Rik, LOC381127, D930044O18Rik
MMRRC Submission 045923-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R7871 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 22477303-22663284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22657281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1764 (T1764A)
Ref Sequence ENSEMBL: ENSMUSP00000095260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655]
AlphaFold no structure available at present
Predicted Effect not run
Transcript: ENSMUST00000097655
AA Change: T1764A
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: T1764A

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,331,092 (GRCm39) S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,361,864 (GRCm39) probably null Het
Arpin A T 7: 79,577,463 (GRCm39) W195R probably damaging Het
Asap1 A G 15: 63,963,925 (GRCm39) V1091A probably damaging Het
Bmp7 C A 2: 172,781,784 (GRCm39) A27S probably benign Het
Ccnh T A 13: 85,359,991 (GRCm39) Y297* probably null Het
Ccno C A 13: 113,124,647 (GRCm39) D72E probably benign Het
Cd70 T G 17: 57,455,770 (GRCm39) T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,514,966 (GRCm39) probably null Het
Chst4 A G 8: 110,757,545 (GRCm39) F106S probably damaging Het
Cntnap3 A C 13: 65,051,587 (GRCm39) L23R probably benign Het
Crybg2 T A 4: 133,814,910 (GRCm39) L1288H probably damaging Het
Cse1l T A 2: 166,777,591 (GRCm39) probably null Het
Cyfip2 T C 11: 46,133,177 (GRCm39) H841R probably damaging Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp4f18 G A 8: 72,742,487 (GRCm39) P498S possibly damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dnah3 T A 7: 119,566,775 (GRCm39) I97F Het
Entpd3 A G 9: 120,389,652 (GRCm39) R313G possibly damaging Het
Erg28 G A 12: 85,866,253 (GRCm39) T75I probably damaging Het
Fam171a1 A G 2: 3,226,421 (GRCm39) H518R probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Galntl6 T C 8: 58,290,222 (GRCm39) E457G probably damaging Het
Glt8d1 A T 14: 30,732,296 (GRCm39) H192L probably damaging Het
Gm15446 T A 5: 110,091,165 (GRCm39) C472* probably null Het
Gm28363 A T 1: 117,625,228 (GRCm39) M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gstp3 T A 19: 4,108,746 (GRCm39) K45* probably null Het
Hsd17b13 A G 5: 104,113,681 (GRCm39) F258L possibly damaging Het
Htt T C 5: 35,021,993 (GRCm39) S1646P probably benign Het
Ipo11 T C 13: 107,028,976 (GRCm39) M326V probably benign Het
Itpr3 T A 17: 27,336,153 (GRCm39) I2293N probably damaging Het
Klk1b8 A G 7: 43,448,750 (GRCm39) probably null Het
Kntc1 T A 5: 123,922,290 (GRCm39) L963H probably damaging Het
Lyst T A 13: 13,810,637 (GRCm39) L769* probably null Het
Map3k13 A G 16: 21,740,346 (GRCm39) S558G probably benign Het
Mbd1 G A 18: 74,407,128 (GRCm39) probably null Het
Mep1a T C 17: 43,790,126 (GRCm39) N408D probably benign Het
Mtrf1 A G 14: 79,644,378 (GRCm39) T229A probably benign Het
Muc4 C T 16: 32,754,935 (GRCm38) S1603L unknown Het
Myo1b A C 1: 51,818,739 (GRCm39) I512S possibly damaging Het
N4bp2 A G 5: 65,964,446 (GRCm39) I832V probably benign Het
Nadsyn1 T A 7: 143,352,233 (GRCm39) K618* probably null Het
Ncstn T C 1: 171,903,023 (GRCm39) D87G probably benign Het
Neurl4 T C 11: 69,794,012 (GRCm39) V156A probably benign Het
Nfasc C A 1: 132,527,751 (GRCm39) G885V not run Het
Nox4 A T 7: 86,963,335 (GRCm39) Y180F possibly damaging Het
Nuggc A G 14: 65,860,700 (GRCm39) T449A probably benign Het
Or6c209 A G 10: 129,483,281 (GRCm39) I95V probably benign Het
Pik3r4 T C 9: 105,540,316 (GRCm39) S735P probably damaging Het
Ppp1r9b T C 11: 94,892,735 (GRCm39) I645T probably damaging Het
Rras2 G A 7: 113,716,783 (GRCm39) probably benign Het
Rtel1 T C 2: 180,962,822 (GRCm39) M25T probably damaging Het
Serpinb3c T A 1: 107,200,883 (GRCm39) Y178F possibly damaging Het
Sh3bp2 A G 5: 34,716,429 (GRCm39) H280R not run Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Skor1 T C 9: 63,053,783 (GRCm39) E62G probably damaging Het
Slc22a22 T A 15: 57,126,751 (GRCm39) N106I possibly damaging Het
Slc44a4 T A 17: 35,142,828 (GRCm39) probably null Het
Sppl2c A G 11: 104,079,342 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stx5a T A 19: 8,732,482 (GRCm39) W384R unknown Het
Topaz1 A G 9: 122,609,765 (GRCm39) Y1111C possibly damaging Het
Ttbk1 T A 17: 46,757,164 (GRCm39) M1157L probably benign Het
Ttn T C 2: 76,578,489 (GRCm39) T24135A probably damaging Het
Ttn T C 2: 76,795,481 (GRCm39) E632G unknown Het
Ttn T C 2: 76,547,559 (GRCm39) T32204A probably benign Het
Vmn2r109 T C 17: 20,760,782 (GRCm39) I858M probably benign Het
Vmn2r71 A T 7: 85,272,869 (GRCm39) Q561L possibly damaging Het
Yme1l1 A G 2: 23,071,077 (GRCm39) D271G probably damaging Het
Zfp629 A G 7: 127,211,167 (GRCm39) F214S probably damaging Het
Zfp709 A G 8: 72,643,308 (GRCm39) I246V probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22,658,280 (GRCm39) missense probably benign 0.41
IGL00510:Asxl3 APN 18 22,656,622 (GRCm39) missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22,655,503 (GRCm39) missense probably benign 0.06
IGL01074:Asxl3 APN 18 22,655,902 (GRCm39) missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22,649,503 (GRCm39) missense probably benign 0.06
IGL01313:Asxl3 APN 18 22,650,516 (GRCm39) missense probably benign 0.41
IGL01349:Asxl3 APN 18 22,657,294 (GRCm39) missense probably benign 0.28
IGL01529:Asxl3 APN 18 22,650,712 (GRCm39) missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22,656,621 (GRCm39) missense probably benign 0.06
IGL01583:Asxl3 APN 18 22,649,654 (GRCm39) missense probably benign 0.01
IGL01619:Asxl3 APN 18 22,656,385 (GRCm39) missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22,658,382 (GRCm39) missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22,655,545 (GRCm39) missense probably benign 0.10
IGL01828:Asxl3 APN 18 22,658,615 (GRCm39) utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22,567,633 (GRCm39) missense probably benign 0.00
IGL01906:Asxl3 APN 18 22,655,338 (GRCm39) missense probably benign 0.01
IGL01962:Asxl3 APN 18 22,655,502 (GRCm39) missense probably benign 0.00
IGL01991:Asxl3 APN 18 22,649,219 (GRCm39) missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22,657,401 (GRCm39) missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22,658,035 (GRCm39) missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22,586,683 (GRCm39) missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22,655,510 (GRCm39) missense probably benign 0.01
IGL02478:Asxl3 APN 18 22,656,070 (GRCm39) missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22,585,456 (GRCm39) missense probably benign 0.19
IGL02660:Asxl3 APN 18 22,657,402 (GRCm39) missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22,657,718 (GRCm39) missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22,656,541 (GRCm39) missense probably benign 0.01
IGL03001:Asxl3 APN 18 22,650,455 (GRCm39) missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22,656,031 (GRCm39) missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22,649,503 (GRCm39) missense probably benign 0.06
BB001:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
BB011:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R0145:Asxl3 UTSW 18 22,586,662 (GRCm39) missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22,656,211 (GRCm39) missense probably benign
R0207:Asxl3 UTSW 18 22,544,553 (GRCm39) splice site probably benign
R0230:Asxl3 UTSW 18 22,585,383 (GRCm39) splice site probably benign
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22,650,668 (GRCm39) missense probably benign 0.00
R0519:Asxl3 UTSW 18 22,656,577 (GRCm39) missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22,656,043 (GRCm39) missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22,654,849 (GRCm39) splice site probably benign
R0626:Asxl3 UTSW 18 22,655,937 (GRCm39) missense probably benign 0.02
R0711:Asxl3 UTSW 18 22,657,508 (GRCm39) missense probably benign 0.01
R0744:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22,658,106 (GRCm39) missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22,657,564 (GRCm39) missense probably benign 0.00
R1372:Asxl3 UTSW 18 22,543,066 (GRCm39) missense probably benign 0.00
R1440:Asxl3 UTSW 18 22,658,281 (GRCm39) missense probably benign 0.13
R1463:Asxl3 UTSW 18 22,649,810 (GRCm39) missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22,649,411 (GRCm39) missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22,650,044 (GRCm39) missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22,585,492 (GRCm39) missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22,655,125 (GRCm39) missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22,650,796 (GRCm39) missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22,585,420 (GRCm39) missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22,656,508 (GRCm39) missense probably benign 0.02
R2174:Asxl3 UTSW 18 22,586,701 (GRCm39) missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22,649,652 (GRCm39) missense probably benign
R2443:Asxl3 UTSW 18 22,544,596 (GRCm39) missense probably benign 0.12
R2907:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22,658,557 (GRCm39) missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22,657,423 (GRCm39) missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22,657,290 (GRCm39) missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4661:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4674:Asxl3 UTSW 18 22,650,795 (GRCm39) missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22,649,826 (GRCm39) missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22,658,511 (GRCm39) missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22,656,369 (GRCm39) missense probably benign 0.06
R5062:Asxl3 UTSW 18 22,655,775 (GRCm39) missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22,649,076 (GRCm39) missense probably benign 0.00
R5065:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22,649,765 (GRCm39) missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22,656,172 (GRCm39) missense probably benign 0.45
R5183:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22,649,496 (GRCm39) missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22,657,551 (GRCm39) missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22,658,304 (GRCm39) missense probably benign 0.28
R5873:Asxl3 UTSW 18 22,649,142 (GRCm39) missense probably benign 0.04
R6240:Asxl3 UTSW 18 22,598,565 (GRCm39) missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22,655,839 (GRCm39) missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22,649,397 (GRCm39) missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22,650,134 (GRCm39) nonsense probably null
R6704:Asxl3 UTSW 18 22,650,362 (GRCm39) missense probably benign 0.00
R6706:Asxl3 UTSW 18 22,586,666 (GRCm39) missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22,658,497 (GRCm39) missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22,598,457 (GRCm39) nonsense probably null
R6811:Asxl3 UTSW 18 22,655,968 (GRCm39) missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22,656,637 (GRCm39) missense probably benign 0.00
R6830:Asxl3 UTSW 18 22,658,445 (GRCm39) missense probably benign 0.45
R6957:Asxl3 UTSW 18 22,655,148 (GRCm39) missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22,656,978 (GRCm39) missense probably benign 0.00
R7058:Asxl3 UTSW 18 22,650,731 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,759 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,758 (GRCm39) nonsense probably null
R7231:Asxl3 UTSW 18 22,650,597 (GRCm39) missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22,544,556 (GRCm39) critical splice acceptor site probably null
R7431:Asxl3 UTSW 18 22,650,010 (GRCm39) missense probably damaging 1.00
R7851:Asxl3 UTSW 18 22,650,279 (GRCm39) missense possibly damaging 0.62
R7880:Asxl3 UTSW 18 22,655,208 (GRCm39) missense possibly damaging 0.90
R7924:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R8061:Asxl3 UTSW 18 22,657,300 (GRCm39) missense possibly damaging 0.62
R8115:Asxl3 UTSW 18 22,650,642 (GRCm39) missense probably damaging 0.99
R8174:Asxl3 UTSW 18 22,650,800 (GRCm39) missense probably benign 0.02
R8303:Asxl3 UTSW 18 22,657,473 (GRCm39) missense probably benign
R8360:Asxl3 UTSW 18 22,649,174 (GRCm39) missense probably benign
R8547:Asxl3 UTSW 18 22,655,829 (GRCm39) missense probably benign 0.04
R8699:Asxl3 UTSW 18 22,567,664 (GRCm39) missense probably benign 0.02
R8774:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8774-TAIL:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8867:Asxl3 UTSW 18 22,649,547 (GRCm39) missense possibly damaging 0.87
R8915:Asxl3 UTSW 18 22,657,763 (GRCm39) missense probably benign 0.00
R8954:Asxl3 UTSW 18 22,650,807 (GRCm39) missense probably damaging 1.00
R9031:Asxl3 UTSW 18 22,657,401 (GRCm39) missense probably damaging 0.96
R9047:Asxl3 UTSW 18 22,585,471 (GRCm39) missense probably damaging 1.00
R9047:Asxl3 UTSW 18 22,585,465 (GRCm39) missense probably damaging 1.00
R9135:Asxl3 UTSW 18 22,657,481 (GRCm39) missense possibly damaging 0.89
R9135:Asxl3 UTSW 18 22,649,670 (GRCm39) missense probably damaging 0.99
R9210:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9212:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9285:Asxl3 UTSW 18 22,654,989 (GRCm39) missense probably damaging 1.00
R9572:Asxl3 UTSW 18 22,649,112 (GRCm39) missense probably benign 0.25
R9707:Asxl3 UTSW 18 22,656,304 (GRCm39) missense probably benign 0.01
R9768:Asxl3 UTSW 18 22,650,101 (GRCm39) missense probably benign 0.00
R9784:Asxl3 UTSW 18 22,650,311 (GRCm39) missense probably benign
Z1088:Asxl3 UTSW 18 22,649,829 (GRCm39) missense probably benign 0.00
Z1176:Asxl3 UTSW 18 22,655,277 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,656,648 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,649,396 (GRCm39) missense probably benign 0.00
Predicted Primers
Posted On 2019-12-20