Mutagenetix > Incidental Mutation

Incidental Mutation 'R7871:Asxl3'

608146

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.360) question?

Stock #

R7871 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22524224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1764 (T1764A)

Ref Sequence

ENSEMBL: ENSMUSP00000095260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655]

AlphaFold

no structure available at present

Predicted Effect

not run
Transcript: ENSMUST00000097655
AA Change: T1764A

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: T1764A

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (64/66)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,183,226	S1041P	probably benign	Het
Aatf	ACACACACACACACACACACACACACACACACACACACACACACACACAC	ACACACACACACACACACACACACACACACACACACACACACACACACACAC	11: 84,471,038		probably null	Het
Arpin	A	T	7: 79,927,715	W195R	probably damaging	Het
Asap1	A	G	15: 64,092,076	V1091A	probably damaging	Het
Bmp7	C	A	2: 172,939,991	A27S	probably benign	Het
Ccnh	T	A	13: 85,211,872	Y297*	probably null	Het
Ccno	C	A	13: 112,988,113	D72E	probably benign	Het
Cd70	T	G	17: 57,148,770	T67P	probably damaging	Het
Chml	CTGTTTG	CTG	1: 175,687,400		probably null	Het
Chst4	A	G	8: 110,030,913	F106S	probably damaging	Het
Cntnap3	A	C	13: 64,903,773	L23R	probably benign	Het
Crybg2	T	A	4: 134,087,599	L1288H	probably damaging	Het
Cse1l	T	A	2: 166,935,671		probably null	Het
Cyfip2	T	C	11: 46,242,350	H841R	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp4f18	G	A	8: 71,988,643	P498S	possibly damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dnah3	T	A	7: 119,967,552	I97F		Het
Entpd3	A	G	9: 120,560,586	R313G	possibly damaging	Het
Erg28	G	A	12: 85,819,479	T75I	probably damaging	Het
Fam171a1	A	G	2: 3,225,384	H518R	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Galntl6	T	C	8: 57,837,188	E457G	probably damaging	Het
Glt8d1	A	T	14: 31,010,339	H192L	probably damaging	Het
Gm15446	T	A	5: 109,943,299	C472*	probably null	Het
Gm28363	A	T	1: 117,697,498	M1L	unknown	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gstp3	T	A	19: 4,058,746	K45*	probably null	Het
Hsd17b13	A	G	5: 103,965,815	F258L	possibly damaging	Het
Htt	T	C	5: 34,864,649	S1646P	probably benign	Het
Ipo11	T	C	13: 106,892,468	M326V	probably benign	Het
Itpr3	T	A	17: 27,117,179	I2293N	probably damaging	Het
Klk8	A	G	7: 43,799,326		probably null	Het
Kntc1	T	A	5: 123,784,227	L963H	probably damaging	Het
Lyst	T	A	13: 13,636,052	L769*	probably null	Het
Map3k13	A	G	16: 21,921,596	S558G	probably benign	Het
Mbd1	G	A	18: 74,274,057		probably null	Het
Mep1a	T	C	17: 43,479,235	N408D	probably benign	Het
Mtrf1	A	G	14: 79,406,938	T229A	probably benign	Het
Muc4	C	T	16: 32,754,935	S1603L	unknown	Het
Myo1b	A	C	1: 51,779,580	I512S	possibly damaging	Het
N4bp2	A	G	5: 65,807,103	I832V	probably benign	Het
Nadsyn1	T	A	7: 143,798,496	K618*	probably null	Het
Ncstn	T	C	1: 172,075,456	D87G	probably benign	Het
Neurl4	T	C	11: 69,903,186	V156A	probably benign	Het
Nfasc	C	A	1: 132,600,013	G885V	not run	Het
Nox4	A	T	7: 87,314,127	Y180F	possibly damaging	Het
Nuggc	A	G	14: 65,623,251	T449A	probably benign	Het
Olfr799	A	G	10: 129,647,412	I95V	probably benign	Het
Pik3r4	T	C	9: 105,663,117	S735P	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,909	I645T	probably damaging	Het
Rras2	G	A	7: 114,117,548		probably benign	Het
Rtel1	T	C	2: 181,321,029	M25T	probably damaging	Het
Serpinb3c	T	A	1: 107,273,153	Y178F	possibly damaging	Het
Sh3bp2	A	G	5: 34,559,085	H280R	not run	Het
Six4	CT	C	12: 73,104,239		probably benign	Het
Skor1	T	C	9: 63,146,501	E62G	probably damaging	Het
Slc22a22	T	A	15: 57,263,355	N106I	possibly damaging	Het
Slc44a4	T	A	17: 34,923,852		probably null	Het
Sppl2c	A	G	11: 104,188,516		probably null	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Stx5a	T	A	19: 8,755,118	W384R	unknown	Het
Topaz1	A	G	9: 122,780,700	Y1111C	possibly damaging	Het
Ttbk1	T	A	17: 46,446,238	M1157L	probably benign	Het
Ttn	T	C	2: 76,717,215	T32204A	probably benign	Het
Ttn	T	C	2: 76,748,145	T24135A	probably damaging	Het
Ttn	T	C	2: 76,965,137	E632G	unknown	Het
Vmn2r109	T	C	17: 20,540,520	I858M	probably benign	Het
Vmn2r71	A	T	7: 85,623,661	Q561L	possibly damaging	Het
Yme1l1	A	G	2: 23,181,065	D271G	probably damaging	Het
Zfp629	A	G	7: 127,611,995	F214S	probably damaging	Het
Zfp709	A	G	8: 71,889,464	I246V	probably benign	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9047:Asxl3	UTSW	18	22452414	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

Posted On

2019-12-20