Incidental Mutation 'R7872:Fer1l5'
ID608152
Institutional Source Beutler Lab
Gene Symbol Fer1l5
Ensembl Gene ENSMUSG00000037432
Gene Namefer-1-like 5 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36372291-36422110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36421886 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2032 (F2032L)
Ref Sequence ENSEMBL: ENSMUSP00000142130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115011
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125304
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140452
SMART Domains Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
Pfam:C2 1 78 1.4e-5 PFAM
Blast:C2 148 209 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152088
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179162
AA Change: F2032L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432
AA Change: F2032L

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192969
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Fer1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4151001:Fer1l5 UTSW 1 36411647 missense probably benign 0.27
R5580:Fer1l5 UTSW 1 36385458 nonsense probably null
R5848:Fer1l5 UTSW 1 36388935 missense probably benign 0.39
R5930:Fer1l5 UTSW 1 36385173 nonsense probably null
R6193:Fer1l5 UTSW 1 36409436 missense probably benign 0.20
R6195:Fer1l5 UTSW 1 36375286 splice site probably null
R6207:Fer1l5 UTSW 1 36385160 missense probably damaging 1.00
R6233:Fer1l5 UTSW 1 36375286 splice site probably null
R6349:Fer1l5 UTSW 1 36411274 missense probably damaging 0.96
R6478:Fer1l5 UTSW 1 36402531 missense probably damaging 1.00
R6514:Fer1l5 UTSW 1 36403616 missense probably benign 0.01
R6611:Fer1l5 UTSW 1 36406654 missense probably benign 0.01
R6634:Fer1l5 UTSW 1 36411385 missense probably damaging 0.99
R6733:Fer1l5 UTSW 1 36408672 critical splice donor site probably null
R6816:Fer1l5 UTSW 1 36406510 missense possibly damaging 0.60
R7225:Fer1l5 UTSW 1 36420952 missense possibly damaging 0.90
R7316:Fer1l5 UTSW 1 36418116 missense probably benign 0.41
R7455:Fer1l5 UTSW 1 36388983 missense probably benign 0.00
R7473:Fer1l5 UTSW 1 36421608 missense possibly damaging 0.53
R7702:Fer1l5 UTSW 1 36420694 nonsense probably null
R7714:Fer1l5 UTSW 1 36401477 missense probably damaging 1.00
R7881:Fer1l5 UTSW 1 36407036 missense not run
R7984:Fer1l5 UTSW 1 36408621 missense possibly damaging 0.68
R8326:Fer1l5 UTSW 1 36376760 missense probably benign 0.04
Z1176:Fer1l5 UTSW 1 36390563 nonsense probably null
Z1177:Fer1l5 UTSW 1 36409194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGCCACTCTTGCATTAGC -3'
(R):5'- GAAAATTACAGCTCTGCTCTTCTTG -3'

Sequencing Primer
(F):5'- CTCTCAGAGCACATTTAAGTTGC -3'
(R):5'- CTTGTCAGAAGTGATCTCTAAACATG -3'
Posted On2019-12-20