Incidental Mutation 'R7872:Lrp4'
ID608156
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91490716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1029 (T1029I)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028689
AA Change: T1029I

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: T1029I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7387:Lrp4 UTSW 2 91476614 missense probably benign
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7968:Lrp4 UTSW 2 91494079 missense possibly damaging 0.74
R8222:Lrp4 UTSW 2 91474741 missense probably damaging 1.00
R8338:Lrp4 UTSW 2 91492368 missense probably benign 0.15
R8342:Lrp4 UTSW 2 91488445 missense probably damaging 1.00
R8435:Lrp4 UTSW 2 91477653 missense probably damaging 1.00
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCTGGAGAACCTCATGGACATTC -3'
(R):5'- ACGGAACCTGATCTCCATCC -3'

Sequencing Primer
(F):5'- GGAGAACCTCATGGACATTCATGTC -3'
(R):5'- GGAACCTGATCTCCATCCTGTCTAC -3'
Posted On2019-12-20