Incidental Mutation 'R7872:Tcp11l1'
ID608157
Institutional Source Beutler Lab
Gene Symbol Tcp11l1
Ensembl Gene ENSMUSG00000027175
Gene Namet-complex 11 like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location104657288-104712169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104706492 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 9 (H9Q)
Ref Sequence ENSEMBL: ENSMUSP00000028597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028597] [ENSMUST00000111118]
Predicted Effect probably benign
Transcript: ENSMUST00000028597
AA Change: H9Q

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028597
Gene: ENSMUSG00000027175
AA Change: H9Q

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 78 502 3.9e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111118
AA Change: H9Q

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106747
Gene: ENSMUSG00000027175
AA Change: H9Q

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 77 505 5.2e-134 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Tcp11l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tcp11l1 APN 2 104706486 missense probably benign
IGL01999:Tcp11l1 APN 2 104698569 missense possibly damaging 0.61
IGL02792:Tcp11l1 APN 2 104681820 missense probably benign 0.19
R0376:Tcp11l1 UTSW 2 104697505 splice site probably benign
R0683:Tcp11l1 UTSW 2 104681892 missense possibly damaging 0.90
R0828:Tcp11l1 UTSW 2 104699836 splice site probably benign
R2091:Tcp11l1 UTSW 2 104684139 missense possibly damaging 0.77
R2095:Tcp11l1 UTSW 2 104681840 missense probably damaging 1.00
R3750:Tcp11l1 UTSW 2 104698542 missense probably damaging 1.00
R4456:Tcp11l1 UTSW 2 104684222 missense probably damaging 1.00
R4926:Tcp11l1 UTSW 2 104681785 missense probably benign 0.01
R5184:Tcp11l1 UTSW 2 104699944 missense probably damaging 1.00
R5461:Tcp11l1 UTSW 2 104688511 missense probably benign 0.00
R6979:Tcp11l1 UTSW 2 104706439 missense probably benign
R7387:Tcp11l1 UTSW 2 104699930 missense possibly damaging 0.92
R7443:Tcp11l1 UTSW 2 104684135 missense probably benign 0.01
R7955:Tcp11l1 UTSW 2 104706492 missense probably benign 0.25
V8831:Tcp11l1 UTSW 2 104685484 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCACGGTAGTGCTTTTAATC -3'
(R):5'- ATGCCCATGACTTACAGGCG -3'

Sequencing Primer
(F):5'- CAAAGTCAGATTTGCTTACAGTGAGG -3'
(R):5'- ATGACTTACAGGCGCCATTG -3'
Posted On2019-12-20