Incidental Mutation 'R7872:Atrn'
ID 608158
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 045924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7872 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 130812147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably null
Transcript: ENSMUST00000028781
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,220,839 (GRCm39) D290N probably damaging Het
Adam18 T C 8: 25,101,116 (GRCm39) D682G probably benign Het
Ankrd46 A G 15: 36,485,989 (GRCm39) V88A possibly damaging Het
Ankub1 T A 3: 57,572,807 (GRCm39) K305I probably damaging Het
Bambi A T 18: 3,511,406 (GRCm39) T76S probably benign Het
Cacna1a T A 8: 85,310,283 (GRCm39) V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Clcn2 A G 16: 20,527,210 (GRCm39) M629T probably damaging Het
Clcn4 T C 7: 7,290,780 (GRCm39) N673S probably benign Het
Col20a1 T C 2: 180,628,371 (GRCm39) F15S probably benign Het
Col2a1 G A 15: 97,898,458 (GRCm39) Q39* probably null Het
Creb3 A G 4: 43,563,332 (GRCm39) E119G probably benign Het
Dnah5 A C 15: 28,245,830 (GRCm39) D556A probably damaging Het
Edar C T 10: 58,446,348 (GRCm39) M192I possibly damaging Het
Fam91a1 A G 15: 58,320,209 (GRCm39) M634V probably benign Het
Fbxo10 C T 4: 45,051,699 (GRCm39) V471I not run Het
Fer1l5 T C 1: 36,460,967 (GRCm39) F2032L probably benign Het
Gm5150 A C 3: 16,060,485 (GRCm39) M1R probably null Het
Grin1 T C 2: 25,188,202 (GRCm39) E509G probably benign Het
Igkv10-94 C T 6: 68,681,913 (GRCm39) probably benign Het
Il18bp A G 7: 101,666,002 (GRCm39) Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 (GRCm39) C17S probably benign Het
Kcnmb1 T C 11: 33,916,275 (GRCm39) Y74H probably damaging Het
Kpna1 T C 16: 35,843,565 (GRCm39) V313A probably benign Het
Lrp4 C T 2: 91,321,061 (GRCm39) T1029I possibly damaging Het
Lrrc7 A T 3: 158,059,099 (GRCm39) C3S probably damaging Het
Lyst C A 13: 13,810,450 (GRCm39) H707N probably benign Het
Map3k20 A G 2: 72,202,098 (GRCm39) K148R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mocs1 T A 17: 49,746,561 (GRCm39) I177N probably damaging Het
Muc5b A G 7: 141,399,850 (GRCm39) D441G unknown Het
Ncoa1 T C 12: 4,328,186 (GRCm39) N884S probably benign Het
Or12j4 A G 7: 140,046,696 (GRCm39) N194S probably damaging Het
Or51a39 A G 7: 102,363,389 (GRCm39) V77A probably benign Het
Padi6 A T 4: 140,455,073 (GRCm39) F621L probably damaging Het
Pde8b C A 13: 95,223,347 (GRCm39) M197I possibly damaging Het
Pear1 T A 3: 87,659,522 (GRCm39) I771L probably benign Het
Poli A G 18: 70,655,891 (GRCm39) L281P probably damaging Het
Prdm12 T C 2: 31,530,231 (GRCm39) W41R probably damaging Het
Prkdc T G 16: 15,532,870 (GRCm39) S1500A probably benign Het
Prune2 T A 19: 17,096,798 (GRCm39) H767Q probably benign Het
Rasgef1b G A 5: 99,382,403 (GRCm39) Q196* probably null Het
Rnpc3 A T 3: 113,416,096 (GRCm39) L121* probably null Het
Rpp14 A G 14: 8,083,724 (GRCm38) M1V probably null Het
Ryr2 T A 13: 11,610,610 (GRCm39) D4072V probably damaging Het
Sgms1 T C 19: 32,102,765 (GRCm39) H314R probably damaging Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Slc37a3 A T 6: 39,324,244 (GRCm39) Y335N probably damaging Het
Tcp11l1 A T 2: 104,536,837 (GRCm39) H9Q probably benign Het
Tnrc6a T A 7: 122,779,057 (GRCm39) M1256K probably damaging Het
Trpc6 A G 9: 8,609,910 (GRCm39) N126S probably damaging Het
Tut4 T G 4: 108,374,715 (GRCm39) C933G probably damaging Het
Ubr4 T C 4: 139,120,373 (GRCm39) F266S possibly damaging Het
Uimc1 A G 13: 55,217,550 (GRCm39) V424A possibly damaging Het
Utrn T C 10: 12,573,873 (GRCm39) I1066V probably benign Het
Vmn1r204 A G 13: 22,740,404 (GRCm39) T12A probably benign Het
Vmn1r57 T A 7: 5,223,613 (GRCm39) I46N possibly damaging Het
Vmn1r91 T C 7: 19,835,839 (GRCm39) Y253H probably benign Het
Vmn2r14 T A 5: 109,369,219 (GRCm39) H118L probably benign Het
Zfp775 A G 6: 48,597,404 (GRCm39) K426R probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTCTCAGCACCATGTATGTG -3'
(R):5'- TACCTGCTAACAGCTTCCAGG -3'

Sequencing Primer
(F):5'- CAGCACCATGTATGTGTTCGGC -3'
(R):5'- AGCTTCCAGGAGCCACATG -3'
Posted On 2019-12-20