Incidental Mutation 'R7872:Lrrc7'
ID608164
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158353462 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 3 (C3S)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably damaging
Transcript: ENSMUST00000106044
AA Change: C3S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: C3S

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199890
AA Change: C3S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: C3S

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200137
AA Change: C3S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: C3S

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200196
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
R8367:Lrrc7 UTSW 3 158202370 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCATTAGGAACTTGAGATTGACAG -3'
(R):5'- AAGTTGTCCTGTGCCTGATTTC -3'

Sequencing Primer
(F):5'- CCTCAATCTGATTGGCATCCAGATAG -3'
(R):5'- CCTGATTTCACATCTTGGGGCAG -3'
Posted On2019-12-20