Incidental Mutation 'R7872:Fbxo10'
ID608167
Institutional Source Beutler Lab
Gene Symbol Fbxo10
Ensembl Gene ENSMUSG00000048232
Gene NameF-box protein 10
SynonymsFBX10, LOC269529
MMRRC Submission
Accession Numbers

Genbank: NM_001024142; MGI: 2686937  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45034247-45084604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45051699 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 471 (V471I)
Ref Sequence ENSEMBL: ENSMUSP00000058233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052236]
Predicted Effect not run
Transcript: ENSMUST00000052236
AA Change: V471I
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232
AA Change: V471I

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Fbxo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Fbxo10 APN 4 45058684 missense probably damaging 0.98
IGL02073:Fbxo10 APN 4 45046349 missense possibly damaging 0.94
IGL02097:Fbxo10 APN 4 45048527 missense probably benign 0.24
IGL02315:Fbxo10 APN 4 45062469 missense probably benign 0.08
IGL02403:Fbxo10 APN 4 45062517 missense probably benign 0.01
IGL02408:Fbxo10 APN 4 45058361 missense possibly damaging 0.75
IGL02496:Fbxo10 APN 4 45043883 missense probably damaging 1.00
IGL02583:Fbxo10 APN 4 45044754 missense probably damaging 1.00
IGL02794:Fbxo10 APN 4 45041928 missense probably benign 0.20
N/A - 287:Fbxo10 UTSW 4 45044708 splice site probably benign
R1033:Fbxo10 UTSW 4 45062236 missense probably damaging 1.00
R1102:Fbxo10 UTSW 4 45043672 missense probably damaging 1.00
R1583:Fbxo10 UTSW 4 45062118 missense probably damaging 1.00
R1586:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R1789:Fbxo10 UTSW 4 45046389 missense probably damaging 1.00
R2187:Fbxo10 UTSW 4 45058531 missense probably benign 0.09
R2191:Fbxo10 UTSW 4 45044811 missense probably damaging 1.00
R2377:Fbxo10 UTSW 4 45044719 missense probably benign 0.18
R2425:Fbxo10 UTSW 4 45051642 missense possibly damaging 0.60
R2495:Fbxo10 UTSW 4 45040545 missense probably benign 0.00
R4105:Fbxo10 UTSW 4 45059054 missense probably benign 0.01
R4472:Fbxo10 UTSW 4 45043693 missense probably damaging 1.00
R4480:Fbxo10 UTSW 4 45048470 missense probably damaging 1.00
R4985:Fbxo10 UTSW 4 45040692 missense probably benign 0.33
R5193:Fbxo10 UTSW 4 45051573 nonsense probably null
R5309:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5312:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5348:Fbxo10 UTSW 4 45058934 missense probably damaging 1.00
R5694:Fbxo10 UTSW 4 45035970 missense probably damaging 1.00
R5844:Fbxo10 UTSW 4 45058760 missense probably benign 0.09
R5974:Fbxo10 UTSW 4 45040631 missense probably benign 0.18
R5990:Fbxo10 UTSW 4 45061960 missense probably damaging 1.00
R6197:Fbxo10 UTSW 4 45043857 missense probably benign 0.03
R6359:Fbxo10 UTSW 4 45041796 missense possibly damaging 0.93
R6808:Fbxo10 UTSW 4 45059035 missense probably benign 0.00
R6873:Fbxo10 UTSW 4 45041787 missense possibly damaging 0.94
R6921:Fbxo10 UTSW 4 45044849 missense probably damaging 1.00
R7089:Fbxo10 UTSW 4 45062230 missense possibly damaging 0.90
R7120:Fbxo10 UTSW 4 45040533 nonsense probably null
R7498:Fbxo10 UTSW 4 45062194 missense probably benign 0.04
R8022:Fbxo10 UTSW 4 45062062 missense possibly damaging 0.93
R8161:Fbxo10 UTSW 4 45044793 missense probably damaging 1.00
R8416:Fbxo10 UTSW 4 45058942 missense possibly damaging 0.83
R8419:Fbxo10 UTSW 4 45041809 missense possibly damaging 0.72
Predicted Primers
Posted On2019-12-20