Incidental Mutation 'R7872:Miip'
ID608171
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Namemigration and invasion inhibitory protein
SynonymsD4Wsu114e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location147860778-147868816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147862918 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 236 (G236S)
Ref Sequence ENSEMBL: ENSMUSP00000113897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
Predicted Effect probably benign
Transcript: ENSMUST00000030886
AA Change: G236S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: G236S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
AA Change: G236S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: G236S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172710
AA Change: G236S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: G236S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6304:Miip UTSW 4 147863083 missense probably benign 0.12
R6568:Miip UTSW 4 147865915 missense probably benign
R6603:Miip UTSW 4 147865923 missense possibly damaging 0.92
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGGTCAGGGAGAAATGTCCTC -3'
(R):5'- AGCTCTCCAGTCACTAGTGAG -3'

Sequencing Primer
(F):5'- AGAAATGTCCTCCCAGGGG -3'
(R):5'- AGTCACTAGTGAGCCCGAG -3'
Posted On2019-12-20