Incidental Mutation 'R7872:Vmn2r14'
ID608173
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Namevomeronasal 2, receptor 14
SynonymsEG231591
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109215502-109224622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109221353 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 118 (H118L)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: H118L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: H118L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109216314 nonsense probably null
IGL01504:Vmn2r14 APN 5 109221419 missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109224577 missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109220409 missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109224483 missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109220067 missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109220588 nonsense probably null
IGL02676:Vmn2r14 APN 5 109220016 missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109221439 missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109220188 missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109221426 missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109216394 missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109216107 missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109220484 missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109219836 missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109219044 missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109218896 missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109216360 missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109224574 missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109216251 missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109221417 missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109219972 missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109219047 nonsense probably null
R2013:Vmn2r14 UTSW 5 109221243 missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109218832 splice site probably null
R2417:Vmn2r14 UTSW 5 109224463 missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109215910 missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109224565 missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109216229 missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109220167 missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109221504 missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109216110 missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109221518 splice site probably null
R4896:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109216095 missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109217576 missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109221288 missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109220395 missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109219950 missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109217620 missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109215858 missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109221356 missense probably benign
R5985:Vmn2r14 UTSW 5 109220216 missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109221417 missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109221267 missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109216230 missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109216059 missense probably benign 0.22
R6944:Vmn2r14 UTSW 5 109216274 missense probably benign 0.06
R7608:Vmn2r14 UTSW 5 109221410 missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109220220 missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7993:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109220554 missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109221476 missense probably damaging 1.00
Z1177:Vmn2r14 UTSW 5 109219875 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCTTGTAGGCACATGTAAATGGAC -3'
(R):5'- GTAATCTAGTTCAAGGTTGGCATTC -3'

Sequencing Primer
(F):5'- GAGTTCAATTCCCAGTAACCATGTGG -3'
(R):5'- GTTCAAGGTTGGCATTCAATAAAAC -3'
Posted On2019-12-20