Incidental Mutation 'R7872:Clcn4'
ID608178
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Namechloride channel, voltage-sensitive 4
SynonymsClc4-2, Clcn4-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location7282309-7300851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7287781 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 673 (N673S)
Ref Sequence ENSEMBL: ENSMUSP00000000619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000210061] [ENSMUST00000210594] [ENSMUST00000211574]
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: N673S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: N673S

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: N642S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: N613S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7287673 missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7294036 missense probably benign 0.01
IGL01650:Clcn4 APN 7 7284281 splice site probably benign
IGL02404:Clcn4 APN 7 7287858 missense probably benign 0.04
IGL02493:Clcn4 APN 7 7284244 missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7296066 missense probably benign
IGL02661:Clcn4 APN 7 7291731 splice site probably null
IGL02816:Clcn4 APN 7 7295088 missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7290465 missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7290420 missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7284258 missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7295091 nonsense probably null
R0379:Clcn4 UTSW 7 7296792 missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7290504 missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7288965 missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7296764 nonsense probably null
R1549:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7293982 missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7284185 makesense probably null
R2764:Clcn4 UTSW 7 7296799 missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7290521 missense probably benign 0.33
R4023:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4154:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4298:Clcn4 UTSW 7 7296738 missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7287814 missense probably benign 0.01
R4574:Clcn4 UTSW 7 7287805 missense probably benign 0.23
R4977:Clcn4 UTSW 7 7291437 missense probably benign 0.00
R5158:Clcn4 UTSW 7 7291619 missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7294051 missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7296033 missense probably benign 0.26
R5624:Clcn4 UTSW 7 7288944 missense probably benign 0.35
R5626:Clcn4 UTSW 7 7289018 missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7291482 missense probably benign 0.00
R6259:Clcn4 UTSW 7 7291530 missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7294025 missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7299182 unclassified probably benign
R7320:Clcn4 UTSW 7 7291828 missense probably benign 0.19
R7562:Clcn4 UTSW 7 7295082 missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7293959 missense probably benign 0.00
R7752:Clcn4 UTSW 7 7293937 missense probably benign
R7860:Clcn4 UTSW 7 7293061 missense probably damaging 1.00
R7895:Clcn4 UTSW 7 7295168 missense probably benign 0.26
R8069:Clcn4 UTSW 7 7296759 missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7291428 missense possibly damaging 0.69
X0019:Clcn4 UTSW 7 7291610 missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7293040 nonsense probably null
Z1177:Clcn4 UTSW 7 7294756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGCTGGCCGCACTATGTAC -3'
(R):5'- TAAAGTGCTTGTTATGACTGTGCC -3'

Sequencing Primer
(F):5'- GGCCGCACTATGTACTCAATC -3'
(R):5'- CCAAACTCCTTTTTGAGATTCTGAG -3'
Posted On2019-12-20