Incidental Mutation 'R7872:Olfr533'
ID608183
Institutional Source Beutler Lab
Gene Symbol Olfr533
Ensembl Gene ENSMUSG00000056883
Gene Nameolfactory receptor 533
SynonymsMOR252-3P, GA_x6K02T2PBJ9-42615403-42616365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140463370-140468128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140466783 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 194 (N194S)
Ref Sequence ENSEMBL: ENSMUSP00000148260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071755] [ENSMUST00000211093] [ENSMUST00000215308] [ENSMUST00000216258] [ENSMUST00000217179]
Predicted Effect probably damaging
Transcript: ENSMUST00000071755
AA Change: N194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071667
Gene: ENSMUSG00000056883
AA Change: N194S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 3e-6 PFAM
Pfam:7tm_1 41 289 5.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211093
AA Change: N194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215308
AA Change: N194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216258
AA Change: N194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217179
AA Change: N194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Olfr533
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr533 APN 7 140466379 missense probably damaging 0.99
IGL02582:Olfr533 APN 7 140466647 missense probably benign
IGL02954:Olfr533 APN 7 140466440 nonsense probably null
R0790:Olfr533 UTSW 7 140467049 missense possibly damaging 0.79
R1754:Olfr533 UTSW 7 140466860 missense probably damaging 1.00
R1965:Olfr533 UTSW 7 140466661 missense probably benign
R2155:Olfr533 UTSW 7 140466591 missense probably benign 0.13
R4613:Olfr533 UTSW 7 140467068 missense probably damaging 1.00
R4836:Olfr533 UTSW 7 140467076 missense probably damaging 1.00
R5493:Olfr533 UTSW 7 140466807 missense probably damaging 1.00
R5694:Olfr533 UTSW 7 140466731 missense probably benign 0.28
R6101:Olfr533 UTSW 7 140466519 missense probably benign 0.31
R6156:Olfr533 UTSW 7 140466845 missense probably benign
R6519:Olfr533 UTSW 7 140466545 missense probably benign 0.01
R6672:Olfr533 UTSW 7 140466735 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466887 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466921 missense probably damaging 1.00
R7086:Olfr533 UTSW 7 140466428 missense possibly damaging 0.89
R7174:Olfr533 UTSW 7 140467163 makesense probably null
R7465:Olfr533 UTSW 7 140466798 missense probably damaging 0.99
R7486:Olfr533 UTSW 7 140466034 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTATGGCACCCTCATG -3'
(R):5'- TTTGTCCAGGAACCCAGCAG -3'

Sequencing Primer
(F):5'- ACTATGGCACCCTCATGAGTGG -3'
(R):5'- AACCCAGCAGTTCCTAGGG -3'
Posted On2019-12-20