Incidental Mutation 'R7872:Trpc6'
ID608187
Institutional Source Beutler Lab
Gene Symbol Trpc6
Ensembl Gene ENSMUSG00000031997
Gene Nametransient receptor potential cation channel, subfamily C, member 6
Synonymsmtrp6, Trrp6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location8544142-8680741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8609909 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 126 (N126S)
Ref Sequence ENSEMBL: ENSMUSP00000057965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596] [ENSMUST00000217462]
Predicted Effect probably damaging
Transcript: ENSMUST00000050433
AA Change: N126S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: N126S

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
ANK 96 125 4.73e2 SMART
ANK 131 159 3.49e0 SMART
ANK 217 246 6.61e-1 SMART
Pfam:TRP_2 252 314 4e-29 PFAM
transmembrane domain 406 427 N/A INTRINSIC
Pfam:Ion_trans 442 738 4.2e-38 PFAM
Pfam:PKD_channel 477 733 3.1e-16 PFAM
low complexity region 770 781 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214596
AA Change: N126S

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000217462
AA Change: N126S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Trpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Trpc6 APN 9 8680438 missense probably damaging 1.00
IGL00469:Trpc6 APN 9 8626701 missense probably benign
IGL00970:Trpc6 APN 9 8653151 missense probably damaging 1.00
IGL01299:Trpc6 APN 9 8653061 missense probably damaging 1.00
IGL01563:Trpc6 APN 9 8656603 missense probably damaging 1.00
IGL01578:Trpc6 APN 9 8634057 missense probably damaging 1.00
IGL02657:Trpc6 APN 9 8643601 missense possibly damaging 0.94
IGL02735:Trpc6 APN 9 8655338 missense probably damaging 1.00
IGL03102:Trpc6 APN 9 8649301 missense probably benign 0.07
P0038:Trpc6 UTSW 9 8649511 missense possibly damaging 0.52
PIT4531001:Trpc6 UTSW 9 8610148 missense probably benign 0.14
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8610275 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8643536 missense probably damaging 1.00
R0334:Trpc6 UTSW 9 8610343 missense probably damaging 1.00
R0665:Trpc6 UTSW 9 8634122 missense probably benign 0.11
R0948:Trpc6 UTSW 9 8610415 missense possibly damaging 0.60
R1177:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1217:Trpc6 UTSW 9 8658286 splice site probably null
R1445:Trpc6 UTSW 9 8680537 missense probably benign 0.00
R1452:Trpc6 UTSW 9 8653147 missense probably damaging 0.99
R1494:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1501:Trpc6 UTSW 9 8610169 missense probably damaging 0.99
R1933:Trpc6 UTSW 9 8656545 missense probably damaging 1.00
R2112:Trpc6 UTSW 9 8656612 missense probably damaging 1.00
R2164:Trpc6 UTSW 9 8610465 nonsense probably null
R2921:Trpc6 UTSW 9 8653033 missense possibly damaging 0.94
R2995:Trpc6 UTSW 9 8544466 missense probably benign 0.30
R3821:Trpc6 UTSW 9 8610278 missense probably damaging 1.00
R3965:Trpc6 UTSW 9 8626621 missense probably damaging 1.00
R4360:Trpc6 UTSW 9 8610266 missense probably benign 0.10
R4625:Trpc6 UTSW 9 8677962 missense probably benign 0.40
R4691:Trpc6 UTSW 9 8652978 missense probably damaging 1.00
R4736:Trpc6 UTSW 9 8609870 missense probably damaging 1.00
R4767:Trpc6 UTSW 9 8643686 missense probably damaging 1.00
R4773:Trpc6 UTSW 9 8609851 missense possibly damaging 0.78
R4792:Trpc6 UTSW 9 8626614 missense probably benign 0.00
R5105:Trpc6 UTSW 9 8649470 missense probably benign
R5319:Trpc6 UTSW 9 8609921 missense probably damaging 1.00
R5429:Trpc6 UTSW 9 8634074 nonsense probably null
R5505:Trpc6 UTSW 9 8626735 missense probably damaging 1.00
R5657:Trpc6 UTSW 9 8609807 missense probably benign 0.11
R5684:Trpc6 UTSW 9 8653128 missense probably damaging 1.00
R5722:Trpc6 UTSW 9 8680549 missense possibly damaging 0.88
R6210:Trpc6 UTSW 9 8656730 missense probably benign 0.42
R6284:Trpc6 UTSW 9 8643600 missense possibly damaging 0.93
R6773:Trpc6 UTSW 9 8634057 missense probably damaging 1.00
R6874:Trpc6 UTSW 9 8680438 missense probably damaging 1.00
R7032:Trpc6 UTSW 9 8609950 missense probably damaging 1.00
R7142:Trpc6 UTSW 9 8653016 nonsense probably null
R7489:Trpc6 UTSW 9 8656544 missense probably benign 0.00
R7631:Trpc6 UTSW 9 8626701 missense probably benign
R7762:Trpc6 UTSW 9 8653149 missense possibly damaging 0.91
R7895:Trpc6 UTSW 9 8655218 missense probably damaging 1.00
R7911:Trpc6 UTSW 9 8656704 missense probably benign
R8115:Trpc6 UTSW 9 8609981 missense probably damaging 1.00
R8183:Trpc6 UTSW 9 8653149 missense possibly damaging 0.91
R8435:Trpc6 UTSW 9 8610440 missense probably damaging 1.00
Z1176:Trpc6 UTSW 9 8655213 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTGCAGCCGGGGTAATGAAAAC -3'
(R):5'- GCCTTCAGCAAAAGCTGGATG -3'

Sequencing Primer
(F):5'- GGGTAATGAAAACAGACTGACTCACC -3'
(R):5'- CTTCAGCAAAAGCTGGATGGTTGAG -3'
Posted On2019-12-20