Incidental Mutation 'R7872:Edar'
ID608189
Institutional Source Beutler Lab
Gene Symbol Edar
Ensembl Gene ENSMUSG00000003227
Gene Nameectodysplasin-A receptor
Synonymsanhidrotic ectodysplasin receptor 1, ectodermal dysplasia receptor, ectodysplasin A1 isoform receptor (EDA-A1R), downless (dl), ED1R, ED3, ED5, EDA3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58600789-58675654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58610526 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 192 (M192I)
Ref Sequence ENSEMBL: ENSMUSP00000003312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003312
AA Change: M192I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227
AA Change: M192I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Edar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58628638 missense probably damaging 1.00
IGL01551:Edar APN 10 58606038 splice site probably benign
IGL02207:Edar APN 10 58610521 missense probably damaging 0.99
IGL02391:Edar APN 10 58628581 missense probably damaging 0.96
IGL03152:Edar APN 10 58609995 missense possibly damaging 0.88
achtung2 UTSW 10 58603163 missense probably damaging 1.00
two-tone UTSW 10 58603179 missense probably damaging 1.00
ANU23:Edar UTSW 10 58628638 missense probably damaging 1.00
R0113:Edar UTSW 10 58629449 missense probably damaging 1.00
R0413:Edar UTSW 10 58629440 missense probably benign 0.00
R0927:Edar UTSW 10 58629491 splice site probably null
R1217:Edar UTSW 10 58628631 missense probably damaging 1.00
R1458:Edar UTSW 10 58607366 missense probably benign 0.27
R1651:Edar UTSW 10 58606053 missense possibly damaging 0.49
R3820:Edar UTSW 10 58621363 missense probably damaging 1.00
R3932:Edar UTSW 10 58610342 missense probably damaging 1.00
R4050:Edar UTSW 10 58609947 missense possibly damaging 0.74
R4911:Edar UTSW 10 58621324 missense probably benign 0.03
R4924:Edar UTSW 10 58629375 missense probably damaging 1.00
R4998:Edar UTSW 10 58606093 missense probably damaging 1.00
R5311:Edar UTSW 10 58607435 missense possibly damaging 0.68
R5314:Edar UTSW 10 58607360 missense probably benign 0.00
R5371:Edar UTSW 10 58607452 missense possibly damaging 0.64
R5566:Edar UTSW 10 58628641 missense possibly damaging 0.50
R5847:Edar UTSW 10 58603179 missense probably damaging 1.00
R7330:Edar UTSW 10 58610554 missense probably damaging 0.98
R7529:Edar UTSW 10 58612008 missense probably benign
R7812:Edar UTSW 10 58630104 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGTACAGACCTGGGGC -3'
(R):5'- GTTTGAGAGCCAGGTCCTTAGG -3'

Sequencing Primer
(F):5'- CTTTCCTGGGGGACTGCTACAG -3'
(R):5'- GGTCCTTAGGCCAAGAATGATCTATG -3'
Posted On2019-12-20