Incidental Mutation 'R7872:Ncoa1'
ID608192
Institutional Source Beutler Lab
Gene Symbol Ncoa1
Ensembl Gene ENSMUSG00000020647
Gene Namenuclear receptor coactivator 1
SynonymsbHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location4247362-4477182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4278186 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 884 (N884S)
Ref Sequence ENSEMBL: ENSMUSP00000151358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000220434]
Predicted Effect probably benign
Transcript: ENSMUST00000085814
AA Change: N884S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: N884S

DomainStartEndE-ValueType
HLH 29 86 1.73e-9 SMART
PAS 111 178 1.32e-10 SMART
Pfam:PAS_11 259 370 8e-37 PFAM
low complexity region 419 441 N/A INTRINSIC
Pfam:NCOA_u2 468 591 1.3e-29 PFAM
Pfam:SRC-1 632 712 3.5e-26 PFAM
low complexity region 724 736 N/A INTRINSIC
PDB:3RVF|B 747 767 1e-6 PDB
low complexity region 777 785 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
Pfam:Nuc_rec_co-act 930 977 2.3e-23 PFAM
low complexity region 1059 1080 N/A INTRINSIC
low complexity region 1125 1137 N/A INTRINSIC
DUF1518 1155 1211 7.47e-16 SMART
DUF1518 1218 1274 1.14e-11 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217674
AA Change: N773S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217794
AA Change: N884S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218191
Predicted Effect probably benign
Transcript: ENSMUST00000220434
AA Change: N884S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Ncoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ncoa1 APN 12 4278218 missense probably benign
IGL01335:Ncoa1 APN 12 4297520 missense probably benign 0.31
IGL02111:Ncoa1 APN 12 4274944 start codon destroyed probably null
IGL02863:Ncoa1 APN 12 4297513 missense probably benign 0.00
IGL02967:Ncoa1 APN 12 4295294 missense probably damaging 1.00
IGL03007:Ncoa1 APN 12 4339114 missense possibly damaging 0.92
IGL03031:Ncoa1 APN 12 4274818 missense possibly damaging 0.76
IGL03048:Ncoa1 UTSW 12 4267922 missense probably damaging 0.96
IGL03147:Ncoa1 UTSW 12 4259342 missense probably damaging 1.00
PIT1430001:Ncoa1 UTSW 12 4323005 missense probably benign 0.19
PIT4402001:Ncoa1 UTSW 12 4294987 missense probably benign 0.00
R0002:Ncoa1 UTSW 12 4290885 missense probably benign 0.00
R0011:Ncoa1 UTSW 12 4322896 missense possibly damaging 0.94
R0389:Ncoa1 UTSW 12 4295976 missense probably benign 0.05
R0467:Ncoa1 UTSW 12 4267687 missense possibly damaging 0.49
R0480:Ncoa1 UTSW 12 4339105 missense probably damaging 1.00
R0541:Ncoa1 UTSW 12 4323033 missense probably damaging 1.00
R0671:Ncoa1 UTSW 12 4249758 splice site probably null
R1387:Ncoa1 UTSW 12 4274790 missense probably benign 0.01
R1426:Ncoa1 UTSW 12 4270737 splice site probably benign
R1538:Ncoa1 UTSW 12 4270748 missense possibly damaging 0.94
R1577:Ncoa1 UTSW 12 4295196 missense probably damaging 0.99
R1902:Ncoa1 UTSW 12 4339049 missense possibly damaging 0.78
R1905:Ncoa1 UTSW 12 4295433 missense probably damaging 1.00
R2026:Ncoa1 UTSW 12 4267647 missense probably benign 0.19
R2259:Ncoa1 UTSW 12 4315819 missense probably damaging 1.00
R2317:Ncoa1 UTSW 12 4275189 missense probably damaging 0.99
R3608:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R4042:Ncoa1 UTSW 12 4267871 missense probably damaging 0.99
R4688:Ncoa1 UTSW 12 4315781 missense probably benign 0.26
R4763:Ncoa1 UTSW 12 4275297 missense probably damaging 1.00
R4878:Ncoa1 UTSW 12 4275004 missense probably damaging 1.00
R5062:Ncoa1 UTSW 12 4259333 missense probably damaging 0.99
R5531:Ncoa1 UTSW 12 4253746 missense probably benign
R6393:Ncoa1 UTSW 12 4278181 missense probably benign 0.00
R6711:Ncoa1 UTSW 12 4322904 missense probably benign 0.26
R7066:Ncoa1 UTSW 12 4322934 missense possibly damaging 0.90
R7109:Ncoa1 UTSW 12 4322978 missense possibly damaging 0.63
R7170:Ncoa1 UTSW 12 4249722 missense probably benign 0.32
R7395:Ncoa1 UTSW 12 4295188 missense not run
R7453:Ncoa1 UTSW 12 4259307 missense probably damaging 1.00
R7556:Ncoa1 UTSW 12 4270794 missense probably damaging 0.98
R7821:Ncoa1 UTSW 12 4296221 missense probably benign 0.00
R7885:Ncoa1 UTSW 12 4339044 missense probably damaging 1.00
R7936:Ncoa1 UTSW 12 4335873 missense possibly damaging 0.53
R7940:Ncoa1 UTSW 12 4313095 missense possibly damaging 0.50
R8126:Ncoa1 UTSW 12 4290951 missense probably damaging 1.00
R8176:Ncoa1 UTSW 12 4267858 missense possibly damaging 0.90
R8510:Ncoa1 UTSW 12 4259303 missense probably benign
Z1177:Ncoa1 UTSW 12 4306514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCGTGCACACTGGGATC -3'
(R):5'- GCACTTTCAGAGAGCTGCTAC -3'

Sequencing Primer
(F):5'- ATCCAGTCTGGGGAGGGTAGC -3'
(R):5'- GAAATCCTGCTCTCCTGT -3'
Posted On2019-12-20