Incidental Mutation 'R7872:Fam91a1'
ID608203
Institutional Source Beutler Lab
Gene Symbol Fam91a1
Ensembl Gene ENSMUSG00000037119
Gene Namefamily with sequence similarity 91, member A1
SynonymsD15Ertd621e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location58415468-58457740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58448360 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 634 (M634V)
Ref Sequence ENSEMBL: ENSMUSP00000036524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037270]
Predicted Effect probably benign
Transcript: ENSMUST00000037270
AA Change: M634V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036524
Gene: ENSMUSG00000037119
AA Change: M634V

DomainStartEndE-ValueType
Pfam:FAM91_N 8 312 2.8e-149 PFAM
Pfam:FAM91_C 374 821 3.8e-182 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Fam91a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fam91a1 APN 15 58430735 missense probably damaging 0.99
IGL00590:Fam91a1 APN 15 58415716 missense possibly damaging 0.66
IGL01301:Fam91a1 APN 15 58442871 missense probably damaging 0.99
IGL01372:Fam91a1 APN 15 58430062 missense probably damaging 1.00
IGL01979:Fam91a1 APN 15 58432584 missense probably damaging 1.00
IGL02085:Fam91a1 APN 15 58441656 missense possibly damaging 0.95
IGL02553:Fam91a1 APN 15 58432982 critical splice donor site probably null
IGL02605:Fam91a1 APN 15 58431196 splice site probably benign
IGL02882:Fam91a1 APN 15 58453061 splice site probably benign
IGL02894:Fam91a1 APN 15 58443231 missense probably benign 0.09
ANU18:Fam91a1 UTSW 15 58442871 missense probably damaging 0.99
H8562:Fam91a1 UTSW 15 58427121 splice site probably null
R0395:Fam91a1 UTSW 15 58454792 missense probably benign
R1165:Fam91a1 UTSW 15 58430669 missense possibly damaging 0.90
R1699:Fam91a1 UTSW 15 58432948 missense probably benign 0.04
R1749:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R1997:Fam91a1 UTSW 15 58424195 critical splice acceptor site probably null
R2042:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R2188:Fam91a1 UTSW 15 58430663 missense probably damaging 0.98
R2518:Fam91a1 UTSW 15 58450600 missense possibly damaging 0.92
R3124:Fam91a1 UTSW 15 58421889 missense probably benign 0.34
R3916:Fam91a1 UTSW 15 58430734 missense probably damaging 1.00
R4810:Fam91a1 UTSW 15 58434740 missense probably damaging 1.00
R4959:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R4973:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R5288:Fam91a1 UTSW 15 58448394 missense probably benign
R5385:Fam91a1 UTSW 15 58448394 missense probably benign
R5386:Fam91a1 UTSW 15 58448394 missense probably benign
R5941:Fam91a1 UTSW 15 58431317 missense probably benign 0.01
R6415:Fam91a1 UTSW 15 58442917 missense probably damaging 1.00
R6869:Fam91a1 UTSW 15 58431268 missense probably benign 0.00
R7175:Fam91a1 UTSW 15 58430678 missense probably benign 0.06
X0024:Fam91a1 UTSW 15 58430189 missense probably damaging 0.98
Z1177:Fam91a1 UTSW 15 58432548 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCCATAGAAAAGGAGCTGTCC -3'
(R):5'- GCAGATGCCATGGTGCAATG -3'

Sequencing Primer
(F):5'- CTCTGACATGTCTTCACTGGAATTG -3'
(R):5'- CAATGCTGAGTGAACACAGTTCTGC -3'
Posted On2019-12-20