Incidental Mutation 'R7872:Clcn2'
ID 608206
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms nmf240, Clc2, ClC-2
MMRRC Submission 045924-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R7872 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 20521714-20536496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20527210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 629 (M629T)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably damaging
Transcript: ENSMUST00000007207
AA Change: M629T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: M629T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: M612T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: M612T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect probably damaging
Transcript: ENSMUST00000232309
AA Change: M585T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,220,839 (GRCm39) D290N probably damaging Het
Adam18 T C 8: 25,101,116 (GRCm39) D682G probably benign Het
Ankrd46 A G 15: 36,485,989 (GRCm39) V88A possibly damaging Het
Ankub1 T A 3: 57,572,807 (GRCm39) K305I probably damaging Het
Atrn T A 2: 130,812,147 (GRCm39) probably null Het
Bambi A T 18: 3,511,406 (GRCm39) T76S probably benign Het
Cacna1a T A 8: 85,310,283 (GRCm39) V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Clcn4 T C 7: 7,290,780 (GRCm39) N673S probably benign Het
Col20a1 T C 2: 180,628,371 (GRCm39) F15S probably benign Het
Col2a1 G A 15: 97,898,458 (GRCm39) Q39* probably null Het
Creb3 A G 4: 43,563,332 (GRCm39) E119G probably benign Het
Dnah5 A C 15: 28,245,830 (GRCm39) D556A probably damaging Het
Edar C T 10: 58,446,348 (GRCm39) M192I possibly damaging Het
Fam91a1 A G 15: 58,320,209 (GRCm39) M634V probably benign Het
Fbxo10 C T 4: 45,051,699 (GRCm39) V471I not run Het
Fer1l5 T C 1: 36,460,967 (GRCm39) F2032L probably benign Het
Gm5150 A C 3: 16,060,485 (GRCm39) M1R probably null Het
Grin1 T C 2: 25,188,202 (GRCm39) E509G probably benign Het
Igkv10-94 C T 6: 68,681,913 (GRCm39) probably benign Het
Il18bp A G 7: 101,666,002 (GRCm39) Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 (GRCm39) C17S probably benign Het
Kcnmb1 T C 11: 33,916,275 (GRCm39) Y74H probably damaging Het
Kpna1 T C 16: 35,843,565 (GRCm39) V313A probably benign Het
Lrp4 C T 2: 91,321,061 (GRCm39) T1029I possibly damaging Het
Lrrc7 A T 3: 158,059,099 (GRCm39) C3S probably damaging Het
Lyst C A 13: 13,810,450 (GRCm39) H707N probably benign Het
Map3k20 A G 2: 72,202,098 (GRCm39) K148R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mocs1 T A 17: 49,746,561 (GRCm39) I177N probably damaging Het
Muc5b A G 7: 141,399,850 (GRCm39) D441G unknown Het
Ncoa1 T C 12: 4,328,186 (GRCm39) N884S probably benign Het
Or12j4 A G 7: 140,046,696 (GRCm39) N194S probably damaging Het
Or51a39 A G 7: 102,363,389 (GRCm39) V77A probably benign Het
Padi6 A T 4: 140,455,073 (GRCm39) F621L probably damaging Het
Pde8b C A 13: 95,223,347 (GRCm39) M197I possibly damaging Het
Pear1 T A 3: 87,659,522 (GRCm39) I771L probably benign Het
Poli A G 18: 70,655,891 (GRCm39) L281P probably damaging Het
Prdm12 T C 2: 31,530,231 (GRCm39) W41R probably damaging Het
Prkdc T G 16: 15,532,870 (GRCm39) S1500A probably benign Het
Prune2 T A 19: 17,096,798 (GRCm39) H767Q probably benign Het
Rasgef1b G A 5: 99,382,403 (GRCm39) Q196* probably null Het
Rnpc3 A T 3: 113,416,096 (GRCm39) L121* probably null Het
Rpp14 A G 14: 8,083,724 (GRCm38) M1V probably null Het
Ryr2 T A 13: 11,610,610 (GRCm39) D4072V probably damaging Het
Sgms1 T C 19: 32,102,765 (GRCm39) H314R probably damaging Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Slc37a3 A T 6: 39,324,244 (GRCm39) Y335N probably damaging Het
Tcp11l1 A T 2: 104,536,837 (GRCm39) H9Q probably benign Het
Tnrc6a T A 7: 122,779,057 (GRCm39) M1256K probably damaging Het
Trpc6 A G 9: 8,609,910 (GRCm39) N126S probably damaging Het
Tut4 T G 4: 108,374,715 (GRCm39) C933G probably damaging Het
Ubr4 T C 4: 139,120,373 (GRCm39) F266S possibly damaging Het
Uimc1 A G 13: 55,217,550 (GRCm39) V424A possibly damaging Het
Utrn T C 10: 12,573,873 (GRCm39) I1066V probably benign Het
Vmn1r204 A G 13: 22,740,404 (GRCm39) T12A probably benign Het
Vmn1r57 T A 7: 5,223,613 (GRCm39) I46N possibly damaging Het
Vmn1r91 T C 7: 19,835,839 (GRCm39) Y253H probably benign Het
Vmn2r14 T A 5: 109,369,219 (GRCm39) H118L probably benign Het
Zfp775 A G 6: 48,597,404 (GRCm39) K426R probably benign Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20,522,391 (GRCm39) missense probably benign 0.08
IGL01657:Clcn2 APN 16 20,532,369 (GRCm39) missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20,531,511 (GRCm39) missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20,527,214 (GRCm39) missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20,522,098 (GRCm39) missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20,528,006 (GRCm39) nonsense probably null
IGL03329:Clcn2 APN 16 20,530,902 (GRCm39) missense probably damaging 1.00
Bemr14 UTSW 16 0 () unclassified
R0008:Clcn2 UTSW 16 20,529,140 (GRCm39) missense probably null 1.00
R0454:Clcn2 UTSW 16 20,529,178 (GRCm39) critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20,522,345 (GRCm39) missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20,531,302 (GRCm39) splice site probably benign
R1824:Clcn2 UTSW 16 20,534,712 (GRCm39) missense probably benign 0.04
R4592:Clcn2 UTSW 16 20,527,892 (GRCm39) missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20,522,053 (GRCm39) missense probably benign 0.01
R5374:Clcn2 UTSW 16 20,528,419 (GRCm39) missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20,529,285 (GRCm39) intron probably benign
R5787:Clcn2 UTSW 16 20,522,183 (GRCm39) missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20,532,404 (GRCm39) missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20,530,438 (GRCm39) critical splice donor site probably null
R6663:Clcn2 UTSW 16 20,521,995 (GRCm39) makesense probably null
R6765:Clcn2 UTSW 16 20,526,418 (GRCm39) splice site probably null
R6825:Clcn2 UTSW 16 20,528,408 (GRCm39) utr 3 prime probably benign
R8028:Clcn2 UTSW 16 20,527,512 (GRCm39) missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20,525,946 (GRCm39) missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20,532,168 (GRCm39) missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20,530,930 (GRCm39) missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20,531,080 (GRCm39) missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20,531,414 (GRCm39) missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20,525,979 (GRCm39) missense probably benign 0.00
R9456:Clcn2 UTSW 16 20,534,702 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCTACAGGCTGACACTTTAGG -3'
(R):5'- AGTGGAGTCTCCTGGTAAGG -3'

Sequencing Primer
(F):5'- CTACAGGCTGACACTTTAGGAGAATG -3'
(R):5'- TAAGGCCAGGAGGGGTCC -3'
Posted On 2019-12-20