Incidental Mutation 'R7872:Kpna1'
ID608207
Institutional Source Beutler Lab
Gene Symbol Kpna1
Ensembl Gene ENSMUSG00000022905
Gene Namekaryopherin (importin) alpha 1
Synonymsm-importin-alpha-S1, Rch2, NPI1, mSRP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35978750-36037131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36023195 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000004054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000172534] [ENSMUST00000173696] [ENSMUST00000174500] [ENSMUST00000174737]
Predicted Effect probably benign
Transcript: ENSMUST00000004054
AA Change: V313A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905
AA Change: V313A

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172534
Predicted Effect probably benign
Transcript: ENSMUST00000173696
SMART Domains Protein: ENSMUSP00000134534
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 105 9.3e-31 PFAM
Blast:ARM 114 149 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174500
SMART Domains Protein: ENSMUSP00000133819
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 96 2.8e-31 PFAM
Blast:ARM 114 145 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174737
SMART Domains Protein: ENSMUSP00000133852
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 1 83 1.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. This protein interacts with the recombination activating gene 1 (RAG1) protein and is a putative substrate of the RAG1 ubiquitin ligase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any nervous system or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Poli A G 18: 70,522,820 L281P probably damaging Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Kpna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Kpna1 APN 16 36012889 intron probably benign
IGL01653:Kpna1 APN 16 36020192 missense probably benign
IGL02412:Kpna1 APN 16 36031191 missense probably benign 0.06
IGL03102:Kpna1 APN 16 36012919 missense probably damaging 1.00
IGL03340:Kpna1 APN 16 36000246 missense probably damaging 1.00
R0040:Kpna1 UTSW 16 36023241 missense probably damaging 0.97
R0456:Kpna1 UTSW 16 36002900 missense possibly damaging 0.94
R0457:Kpna1 UTSW 16 36002905 missense probably benign 0.03
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R2225:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2226:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2227:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2251:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2252:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2271:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R3952:Kpna1 UTSW 16 36002882 missense probably benign 0.13
R4771:Kpna1 UTSW 16 36033403 missense probably damaging 1.00
R4954:Kpna1 UTSW 16 36033326 missense probably damaging 1.00
R5075:Kpna1 UTSW 16 36009352 missense probably damaging 1.00
R5824:Kpna1 UTSW 16 36020205 missense possibly damaging 0.91
R5873:Kpna1 UTSW 16 36014228 intron probably benign
R6221:Kpna1 UTSW 16 36020688 missense probably benign 0.02
R6603:Kpna1 UTSW 16 36029520 critical splice acceptor site probably null
R7168:Kpna1 UTSW 16 36015962 intron probably benign
R7447:Kpna1 UTSW 16 36029639 missense probably damaging 1.00
R7897:Kpna1 UTSW 16 36033865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGGTCAGTTCTGCTGCC -3'
(R):5'- CTACAATTGCTACAAGTCACAGGAC -3'

Sequencing Primer
(F):5'- CGTGGTGGATTCCCTAAATAGCC -3'
(R):5'- GTCACAGGACTTGTAGATACTGAG -3'
Posted On2019-12-20